Skip to main content Skip to navigation
Oligo Rat Anti-Mouse F4/80

BD™ AbSeq Oligo Rat Anti-Mouse F4/80

Clone T45-2342 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Gpf480; F480; Emr1; Ly71; DD7A5-7; EGF-TM7; TM7LN3
13733
2 µl
Rat WI, also known as Wistar (outbred) IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGGAATTAGTTATCGGCGGGAAGCGTAGAGTAGG
AMM2027
Mouse F4/80 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940131 Rev. 2
Antibody Details
Down Arrow Up Arrow
T45-2342

The T45-2342 monoclonal antibody recognizes the mouse F4/80 antigen which is also known as EGF-like module-containing mucin-like hormone receptor-like 1 (EMR1). F4/80 is a 160 kDa glycoprotein that belongs to the EGF-TM7 family of seven-transmembrane spanning cell surface molecules. It is expressed on the surface of granulocytes and a wide range of mature tissue macrophages including, Kupffer cells, splenic red pulp macrophages, microglia, gut lamina propria macrophages, and Langerhans cells. F4/80 expression has also been reported on subpopulations of dendritic cells. F4/80 expression is heterogeneous and may be increased during inflammatory responses as observed in various mouse models of colitis, diabetes and brain injury.

940131 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940131 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940131" on CiteAb

Development References (7)

  1. Austyn JM., and Gordon S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol. 1981; 10:805-815. (Biology). View Reference
  2. Bodhankar S, Lapato A, Chen Y, Vandenbark AA, Saugstad JA, Offner H. Role for microglia in sex differences after ischemic stroke: importance of M2.. Metab Brain Dis. 2015. (Clone-specific: Flow cytometry). View Reference
  3. Gordon S, Hamann J, Lin HH, Stacey M. F4/80 and the related adhesion-GPCRs. Eur J Immunol. 2011; 41(9):2472-2476. (Biology). View Reference
  4. Ito F, Ku AW, Bucsek MJ, et al. Immune Adjuvant Activity of Pre-Resectional Radiofrequency Ablation Protects against Local and Systemic Recurrence in Aggressive Murine Colorectal Cancer.. PLoS ONE. 2015; 10(11):e0143370. (Clone-specific: Flow cytometry). View Reference
  5. Krüger T, Benke D, Eitner F, et al. Identification and functional characterization of dendritic cells in the healthy murine kidney and in experimental glomerulonephritis. J Am Soc Nephrol. 2004; 15(3):613-621. (Biology). View Reference
  6. Leenen PJ, Radosević K, Voerman JS, et al. Heterogeneity of mouse spleen dendritic cells: in vivo phagocytic activity, expression of macrophage markers, and subpopulation turnover.. J Immunol. 1998; 160(5):2166-73. (Biology). View Reference
  7. McKnight AJ, Macfarlane AJ, Dri P, Turley L, Willis AC, Gordon S. Molecular cloning of F4/80, a murine macrophage-restricted cell surface glycoprotein with Homology to the G-protein-linked transmembrane & hormone receptor family. J Biol Chem. 1996; 271:486. (Biology). View Reference
View All (7) View Less
940131 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.