Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD43

BD™ AbSeq Oligo Mouse Anti-Human CD43

Clone 1G10 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
SPN; Sialophorin; Galactoglycoprotein/GALGP; GPL115; LEUK; Leukosialin; LSN
6693
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGGCGGATGGATTTGTCGGTGATATTGCTCTCGTT
AHS0200
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940278 Rev. 2
Antibody Details
Down Arrow Up Arrow
1G10

The 1G10 monoclonal antibody specifically binds to CD43, a 95-135 kDa sialoglycoprotein that is highly expressed on most human leucocytes. CD43 is encoded by the SPN gene and is also known as Sialophorin, Galactoglycoprotein (GALGP), Leukosialin, and Leukocyte sialoglycoprotein. The CD43 antigen is expressed on T cells, pre-B cells and activated B cells, NK cells and granulocytes, but is not present on resting peripheral blood B cells, red blood cells, platelets and non-hematopoietic cells. CD43 is enzymatically shed from leucocyte  surfaces following activation by various stimuli. CD43 appears to be involved in intercellular interactions that regulate T, B, and NK cell functions. This antibody is suitable for staining formalin-fixed, paraffin-embedded tissue sections with TUF pretreatment.

940278 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940278" on CiteAb

Development References (4)

  1. Bazil V, Strominger JL. CD43, the major sialoglycoprotein of human leukocytes, is proteolytically cleaved from the surface of stimulated lymphocytes and granulocytes. Proc Natl Acad Sci U S A. 1993 May; 90(9):3792-3796. (Biology). View Reference
  2. Borche L, Lozano F, Vilella R, Vives J. CD43 monoclonal antibodies recognize the large sialoglycoprotein of human leukocytes. Eur J Immunol. 1987; 17(10):1523-1526. (Biology). View Reference
  3. Horejsi V, Stockinger H. CD43 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:494-497.
  4. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
940278 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.