Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD278

BD™ AbSeq Oligo Rat Anti-Mouse CD278

Clone 7E.17G9 (RUO)

633751
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
ICOS; Ailim; CCLP; CRP-1; Ly115; Inducible T-cell costimulator
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGAATTGAAGCGTTTGTAAGTCCGTAGCCTAGTTG
AMM2072
Mouse Icos cDNA and ICOS hexahistidine fusion protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940176 Rev. 2
Antibody Details
Down Arrow
7E.17G9

The 7E.17G9 monoclonal antibody specifically binds to CD278, the Inducible Costimulatory molecule (ICOS), a 47-57 kDa homodimeric glycoprotein of the CD28 family of costimulatory molecules. ICOS is expressed on subpopulations of CD4-CD8- and CD4+CD8- (but not CD4-CD8+ or CD4+CD8+) thymocytes, on some T-cell lines, and on small numbers of peripheral leukocytes. It is upregulated on T lymphocytes following activation via the T-cell receptor. The T-cell activation marker H4 is the same molecule as  ICOS. ICOS is a costimulatory receptor, and its ligand on antigen-presenting cells has been called B7RP-1, GL50, B7h, B7-H2, or LICOS. There is considerable evidence that the interaction of ICOS with its ligand is involved in the regulation of many, but not all, T-cell-mediated immune responses.

940176 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940176 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Buonfiglio D, Bragardo M, Redoglia V, et al. The T cell activation molecule H4 and the CD28-like molecule ICOS are identical. Eur J Immunol. 2000; 30(12):3463-3467. (Biology). View Reference
  2. Chambers CA. The expanding world of co-stimulation: the two-signal model revisited. Trends Immunol. 2001; 22(4):217-223. (Biology). View Reference
  3. Dong C, Temann UA, Flavell RA. Cutting edge: critical role of inducible costimulator in germinal center reactions. J Immunol. 2001; 166(6):3659-3662. (Biology). View Reference
  4. Mages HW, Hutloff A, Heuck C, et al. Molecular cloning and characterization of murine ICOS and identification of B7h as ICOS ligand. Eur J Immunol. 2000; 30(4):1040-1047. (Biology). View Reference
  5. McAdam AJ, Chang TT, Lumelsky AE, et al. Mouse inducible costimulatory molecule (ICOS) expression is enhanced by CD28 costimulation and regulates differentiation of CD4+ T cells.. J Immunol. 2000; 165(9):5035-40. (Immunogen: ELISA, Flow cytometry). View Reference
  6. Schwartz RH. Immunology. It takes more than two to tango. Nature. 2001; 409(6816):31-32. (Biology). View Reference
  7. Sperling AI, Bluestone JA. ICOS costimulation: It's not just for TH2 cells anymore. Nat Immunol. 2001; 2(7):573-574. (Biology). View Reference
  8. Wallin JJ, Liang L, Bakardjiev A, Sha WC. Enhancement of CD8+ T cell responses by ICOS/B7h costimulation. J Immunol. 2001; 167(1):132-139. (Biology). View Reference
View All (8) View Less
940176 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.