Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse Siglec-G

BD™ AbSeq Oligo Mouse Anti-Mouse Siglec-G

Clone SH1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Siglecg; mSiglec-G; Siglec10; Siglec 10; CD330
243958
2 µl
Mouse IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTGAAGTGTAGGCTCGAATTTAATAGGGAAGTGCT
AMM2123
Mouse Extracellular Siglec-G Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940397 Rev. 2
Antibody Details
Down Arrow Up Arrow
SH1

The SH1 monoclonal antibody specifically binds to mouse Siglec-G (sialic acid binding immunoglobulin-like lectin G), also known as Siglec10. Siglec-G is a Type I transmembrane glycoprotein that belongs to the Immunoglobulin superfamily. Siglec-G functions as an adhesion molecule that mediates sialic-acid dependent binding to cells. Siglec-G is expressed on cells of the B cell lineage. Siglec-G is most highly expressed by pre-B cells and B1a cells within the B cell lineage and is not detectable on T cells. Siglec-G can inhibit B cell receptor-mediated calcium signaling when it is overexpressed. Mice that lack Siglec-G have significantly increased numbers of B1a cells that begins early in development and is B cell intrinsic. Siglec-G-deficient mice have higher titers of natural IgM antibodies than their normal counterparts. Mouse Siglec-G is the ortholog of human Siglec-10 (also known as, CD330).

940397 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940397 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940397" on CiteAb

Development References (5)

  1. Aizawa H, Zimmermann N, Carrigan PE, Lee JJ, Rothenberg ME, Bochner BS. Molecular analysis of human Siglec-8 orthologs relevant to mouse eosinophils: identification of mouse orthologs of Siglec-5 (mSiglec-F) and Siglec-10 (mSiglec-G). Genomics. 2003; 82(5):521-530. (Biology). View Reference
  2. Hoffmann A, Kerr S, Jellusova J, et al. Siglec-G is a B1 cell-inhibitory receptor that controls expansion and calcium signaling of the B1 cell population. Nat Immunol. 2007; 8(7):695-704. (Biology). View Reference
  3. Hutzler S, Özgör L, Naito-Matsui Y, et al. The ligand-binding domain of Siglec-G is crucial for its selective inhibitory function on B1 cells.. J Immunol. 2014; 192(11):5406-14. (Immunogen: Flow cytometry). View Reference
  4. Jellusova J, Düber S, Gückel E, et al. Siglec-G regulates B1 cell survival and selection. J Immunol. 2010; 185(6):3277-3284. (Biology). View Reference
  5. Nitschke L. CD22 and Siglec-G: B-cell inhibitory receptors with distinct functions. Immunol Rev. 2009; 230(1):128-143. (Biology). View Reference
940397 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.