Dear Customer, If you experience any text readability or display issues on our website, please update your web browser to the latest version
See More
Product Details
BD™ AbSeq
LPS receptor; LPS-R; Myeloid cell-specific leucine-rich glycoprotein
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGCCCGTGGTAGCGCAATGTGAGATCGTAATAAGT
AHS0037
Human Monocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse
Preparation And Storage
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
Recommended Assay Procedures
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.
BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Product Notices
- This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
- The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
- Please refer to bd.com/genomics-resources for technical protocols.
- Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
- Source of all serum proteins is from USDA inspected abattoirs located in the United States.
- Illumina is a trademark of Illumina, Inc.
- Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
- For U.S. patents that may apply, see bd.com/patents.
Companion Products
Human BD Fc Block™ RUO
Size
50 µg
Cat No.
564219
Human BD Fc Block™ RUO
Size
0.25 µg
Cat No.
564220
Stain Buffer (FBS) RUO
Size
500 ML
Cat No.
554656
Single-Cell Analysis System RUO
Size
1 EA
Cat No.
633701
Cartridge Reagent Kit RUO
Size
1 Each
Cat No.
633731
Cat No.
633702
940005 Rev. 3
Antibody Details
MφP9
The MΦP9 monoclonal antibody specifically binds to CD14. CD14 is a 53-55 kDa glycosylphosphatidylinositol (GPI)-anchored and single chain glycoprotein expressed at high levels on monocytes. Additionally, this CD14-specific antibody reacts with interfollicular macrophages, reticular dendritic cells and some Langerhans cells. CD14 has been identified as a high affinity cell-surface receptor for complexes of lipopolysaccharide (LPS) and serum LPS-binding protein, LPB. This antibody is suitable for staining acetone-fixed, frozen tissue sections.
940005 Rev. 3
Format Details
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940005 Rev.3
Citations & References
View product citations for antibody "940005" on CiteAb
Development References (4)
-
Dimitriu-Bona A, Burmester GR, Kelley K, Winchester RJ. Human mononuclear phagocyte differentiation antigens: Definition by monoclonal antibodies, cell distribution, and in vitro modulation. In: Bernard A, Boumsell L, Dausset J, Milstein C, Schlossman SF, ed. Leukocyte Typing. New York: Springer-Verlag; 1984:434-437.
-
Dimitriu-Bona A, Burmester GR, Waters SJ, Winchester RJ. Human mononuclear phagocyte differentiation antigens. I. Patterns of antigenic expression on the surface of human monocytes and macrophages defined by monoclonal antibodies. J Immunol. 1983; 130(1):145-152. (Immunogen: Flow cytometry, Immunofluorescence). View Reference
-
Goyert SM, Ferrero E. Biochemical analysis of myeloid antigens and cDNA expression of gp55 (CD14). In: McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:613-619.
-
Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS binding protein. Science. 1990; 249(4975):1431-1433. (Biology). View Reference
940005 Rev. 3
Please refer to Support Documents for Quality Certificates
Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described
Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims. Comparisons are not made against non-BD technologies, unless otherwise noted.
For Research Use Only. Not for use in diagnostic or therapeutic procedures.