Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse H-2D[d]

BD™ AbSeq Oligo Mouse Anti-Mouse H-2D[d]

Clone 34-2-12 (RUO)

940423
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Histocompatibility-2Dd; H-2Dd
14964
2 µl
Mouse C3H, also known as C3H/He, C3H/Bi IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATGGAGGTTCGTGACTTAATCGTGTTCGTTGTTCTT
AMM2180
(C57BL/6 x DBA/2)F1 mouse splenocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940423 Rev. 2
Antibody Details
Down Arrow
34-2-12

The 34-2-12 antibody (also known as 34-2-12S) recognizes the α3 domain of the H-2D[d]. The binding of the antibody to its epitope is independent of the α1 and α2 domains and β2 microglobulin.  It cross-reacts with cells of the C3H.LG/Ckc strain. Reactivity with other haplotypes (eg, b, f, k, p, q, r, s) has not been observed. Soluble mAb 34-2-12 blocks binding of the Ly-49A-expressing T lymphoma EL4 to immobilized H-2D[d].  However, further studies utilizing this mAb indicate that the α3 domain is not involved in the interaction between Ly-49A, or Ly-49G2, and H-2D[d].

940423 Rev. 2
Format Details
Down Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940423 Rev.2
Citations & References
Down Arrow

Development References (9)

  1. Daniels BF, Karlhofer FM, Seaman WE, Yokoyama WM. A natural killer cell receptor specific for a major histocompatibility complex class I molecule. J Exp Med. 1994; 180(2):687-692. (Clone-specific: Blocking). View Reference
  2. Evans GA, Margulies DH, Shykind B, Seidman JG, Ozato K. Exon shuffling: mapping polymorphic determinants on hybrid mouse transplantation antigens. Nature. 1982; 300(5894):755-757. (Biology). View Reference
  3. Kane KP. Ly-49 mediates EL4 lymphoma adhesion to isolated class I major histocompatibility complex molecules. J Exp Med. 1994; 179(3):1011-1015. (Clone-specific: Blocking). View Reference
  4. Karlhofer FM, Ribaudo RK, Yokoyama WM. MHC class I alloantigen specificity of Ly-49+ IL-2-activated natural killer cells. Nature. 1992; 358(6381):66-70. (Biology). View Reference
  5. Mason LH, Ortaldo JR, Young HA, Kumar V, Bennett M, Anderson SK. Cloning and functional characteristics of murine large granular lymphocyte-1: a member of the Ly-49 gene family (Ly-49G2). J Exp Med. 1995; 182(2):293-303. (Biology). View Reference
  6. McCluskey J, Bluestone JA, Coligan JE, Maloy WL, Margulies DH. Serologic and T cell recognition of truncated transplantation antigens encoded by in vitro deleted class I major histocompatibility genes. J Immunol. 1986; 136(4):1472-1481. (Clone-specific: Immunoprecipitation). View Reference
  7. McCluskey J, Germain RN, Margulies DH. Cell surface expression of an in vitro recombinant class II/class I major histocompatibility complex gene product. J Immunol. 1985; 40(2):247-257. (Clone-specific: Immunoprecipitation). View Reference
  8. Otten GR, Bikoff E, Ribaudo RK, Kozlowski S, Margulies DH, Germain RN. Peptide and beta 2-microglobulin regulation of cell surface MHC class I conformation and expression. J Immunol. 1992; 148(12):3723-3732. (Biology). View Reference
  9. Ozato K, Mayer NM, Sachs DH. Monoclonal antibodies to mouse major histocompatibility complex antigens.. Transplantation. 1982; 34(3):113-20. (Immunogen: Cytotoxicity). View Reference
View All (9) View Less
940423 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.