Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD33

BD™ AbSeq Oligo Mouse Anti-Human CD33

Clone WM53 (also known as WM-53)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Siglec-3; SIGLEC3; Sialic acid-binding Ig-like lectin 3; p67; gp67; My9
945
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGTTAGTGATTTGATAGGACGCGTTACGAGAGATT
AHS0044
Acute Myeloid Leukemia Blasts
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940031 Rev. 3
Antibody Details
Down Arrow Up Arrow
WM53

The WM53 monoclonal antibody specifically recognizes CD33 which is also known as Sialic acid-binding Ig-like lectin 3 (Siglec-3) or gp67. CD33 is a 67 kDa type I transmembrane glycoprotein that is variably expressed on myeloid progenitors, monocytes, macrophages, dendritic cells, neutrophils, basophils, mast cells, and on some activated T cells and NK cells. Normal lymphocytes, platelets, erythrocytes and pluripotent hematopoietic stem cells do not express the CD33 antigen. This glycoprotein reportedly functions as a sialic acid-dependent cell adhesion molecule and this function can be modulated by endogenous sialoglycoconjugates when CD33 is expressed on the membrane.

940031 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940031 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Favaloro EJ, Bradstock KF, Kabral A, Grimsley P, Berndt MC. Characterization of monoclonal antibodies to the human myeloid-differentiation antigen, 'gp67' (CD-33). Dis Markers. 1987; 5(4):215-225. (Immunogen: Blocking, Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunoprecipitation, Radioimmunoassay). View Reference
  2. Favaloro EJ, Bradstock KF, Kabral A, Grimsley P, Zowtyj H, Zola H. Further characterization of human myeloid antigens (gp160,95; gp150; gp67): investigation of epitopic heterogeneity and non-haemopoietic distribution using panels of monoclonal antibodies belonging to CD-11b, CD-13 and CD-33. Br J Haematol. 1988; 69(2):163-171. (Clone-specific: Blocking, Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunohistochemistry, Radioimmunoassay). View Reference
  3. Favaloro EJ, Moraitis N, Koutts J, Exner T, Bradstock KF. Endothelial cells and normal circulating haemopoietic cells share a number of surface antigens. Thromb Haemost. 1989; 61(2):217-224. (Clone-specific: ELISA). View Reference
  4. Freeman SD, Kelm S, Barber EK, Crocker PR. Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 1995; 85(8):2005-2012. (Biology). View Reference
  5. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  6. Nakamura Y, Noma M, Kidokoro M, et al. Expression of CD33 antigen on normal human activated T lymphocytes.. Blood. 1994; 83(5):1442-3. (Biology). View Reference
View All (6) View Less
940031 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.