Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD103

BD™ AbSeq Oligo Rat Anti-Mouse CD103

Clone M290 (RUO)

554599
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Itgae; Integrin alpha-E; αE; alpha-E1; ITAE; Integrin αIEL chain; aM290
16407
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CATTAGTTAGACGGTAGAGTTGCGAAGAGATAGGCG
AMM2032
Mouse Intestinal Epithelial Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940136 Rev. 2
Antibody Details
Down Arrow
M290

The M290 antibody specificaly binds to CD103, the α chain of αIELβ7 integrin. CD103 has a unique and fairly restricted tissue distribution. It is expressed on almost all intestinal intraepithelial lymphocytes (IEL), dendritic epidermal T cells (DEC), subpopulations of peripheral T cells, and distinct subsets of fetal, neonatal, and adult thymocytes. E-cadherin is the epithelial cell ligand for αIELβ7 integrin. The ordered expression of αIEL during thymocyte development (which occurs under the influence of the thymic epithelium), high level of αIEL expression on peripheral T cells in epithelial tissues (IEL and DEC), and expression of CD103 on a subset of CD8+ lymphocytes responding to allogeneic epithelial cells, suggest that αIELβ7 integrin may have a common role in the interactions of T lymphocytes with epithelia during T-cell maturation and effector functions. CD103 is thought to play a role in allograft rejection. The M290 antibody is reported to efficiently inhibit αIELβ7-mediated adhesion in in vitro assays.

940136 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940136 Rev.2
Citations & References
Down Arrow

Development References (7)

  1. Andrew DP, Rott LS, Kilshaw PJ, Butcher EC. Distribution of alpha 4 beta 7 and alpha E beta 7 integrins on thymocytes, intestinal epithelial lymphocytes and peripheral lymphocytes. Eur J Immunol. 1996; 26(4):897-905. (Clone-specific: Flow cytometry). View Reference
  2. Feng Y, Wang D, Yuan R, Parker CM, Farber DL, Hadley GA. CD103 expression is required for destruction of pancreatic islet allografts by CD8(+) T cells. J Exp Med. 2002; 196(7):877-886. (Biology). View Reference
  3. Hadley GA, Bartlett ST, Via CS, Rostapshova EA, Moainie S. The epithelial cell-specific integrin, CD103 (alpha E integrin), defines a novel subset of alloreactive CD8+ CTL. J Immunol. 1997; 159(8):748-3756. (Biology). View Reference
  4. Karecla PI, Bowden SJ, Green SJ, Kilshaw PJ. Recognition of E-cadherin on epithelial cells by the mucosal T cell integrin alpha M290 beta 7 (alpha E beta 7). Eur J Immunol. 1995; 25(3):852-856. (Clone-specific: Blocking). View Reference
  5. Kilshaw PJ, Baker KC. A unique surface antigen on intraepithelial lymphocytes in the mouse. Immunol Lett. 1988; 18(2):149-154. (Immunogen: Immunofluorescence, Immunohistochemistry, Immunoprecipitation). View Reference
  6. Kilshaw PJ, Murant SJ. A new surface antigen on intraepithelial lymphocytes in the intestine. Eur J Immunol. 1990; 20(10):2201-2207. (Clone-specific: Immunoprecipitation). View Reference
  7. Kilshaw PJ, Murant SJ. Expression and regulation of beta 7(beta p) integrins on mouse lymphocytes: relevance to the mucosal immune system. Eur J Immunol. 1991; 21(10):2591-2597. (Clone-specific: Immunohistochemistry). View Reference
View All (7) View Less
940136 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.