Skip to main content Skip to navigation
Oligo Rat Anti-Mouse TIM-4

BD™ AbSeq Oligo Rat Anti-Mouse TIM-4

Clone 21H12 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TIMD-4, SMUCKLER, Tim4, Timd4
276891
2 µl
Rat LEW, also known as Lewis IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ATTTGGGTGTGTATTTCGGTGTCATTTAGTGCGCTC
AMM2160
Mouse TIM-4 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  2. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  3. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  4. Illumina is a trademark of Illumina, Inc.
  5. Please refer to bd.com/genomics-resources for technical protocols.
  6. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940355 Rev. 2
Antibody Details
Down Arrow Up Arrow
21H12

The 21H12 monoclonal antibody specifically binds to TIM-4. TIM-4 is encoded by Timd4 (T cell immunoglobulin and mucin domain containing 4). TIM-4 is also known as Spleen, mucin-containing, knockout of lymphotoxin protein (SMUCKLER). TIM-4 is a single-pass type I membrane transmembrane glycoprotein belonging to the TIM family of the immunoglobulin superfamily. TIM-4 is expressed by macrophages and at low levels by dendritic cells. TIM-4 is a phosphatidylserine receptor that enhances the phagocytosis of apoptotic cells.  It can also serve as a receptor for TIM-1, also known as the Hepatitis A virus cellular receptor 1 (Havcr1).

940355 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940355 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940355" on CiteAb

Development References (3)

  1. Albacker LA, Karisola P, Chang YJ, et al. TIM-4, a receptor for phosphatidylserine, controls adaptive immunity by regulating the removal of antigen-specific T cells. J Immunol. 2010; 185(11):6839-6849. (Clone-specific: Blocking, Flow cytometry, Fluorescence microscopy, Functional assay, Immunofluorescence). View Reference
  2. Freeman GJ, Casasnovas JM, Umetsu DT, DeKruyff RH. TIM genes: a family of cell surface phosphatidylserine receptors that regulate innate and adaptive immunity.. Immunol Rev. 2010; 235(1):172-89. (Biology). View Reference
  3. Kobayashi N, Karisola P, Pena-Cruz V, et al. TIM-1 and TIM-4 glycoproteins bind phosphatidylserine and mediate uptake of apoptotic cells. Immunity. 2007; 27(6):927-940. (Immunogen: Blocking, Flow cytometry, Functional assay, Inhibition). View Reference
940355 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.