Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD4

BD™ AbSeq Oligo Rat Anti-Mouse CD4

Clone RM4-5 (also known as RM4.5) (RUO)

343648
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Cd4; CD4 antigen; L3T4; Ly-4; T-cell surface antigen T4/Leu-3
12504
2 µl
Rat DA, also known as DA/HA IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTTAGCGTAGGGTGCATTAGAGCGAGTTAGCGAGT
AMM2002
Mouse Thymocytes (BALB/c)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940108 Rev. 2
Antibody Details
Down Arrow
RM4-5

The RM4-5 monoclonal antibody specifically binds to the CD4 (L3T4) differentiation antigen expressed on most thymocytes, subpopulations of mature T lymphocytes (i.e., MHC class II-restricted T cells, including most T helper cells and immunosuppressive regulatory T cells), and a subset of NK-T cells. CD4 has also been reported to be detected on pluripotent hematopoietic stem cells, bone marrow myeloid and B-lymphocyte precursors, intrathymic lymphoid precursors, and a subset of splenic dendritic cells. CD4 has been reported to be expressed on the plasma membrane of mouse egg cells and is involved in adhesion of the egg to MHC class II-bearing sperm. CD4 is an antigen coreceptor on the T-cell surface which interacts with MHC class II molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck. Purified RM4-5 mAb has been reported to block the binding of FITC-conjugated anti-mouse CD4 clones GK1.5 and H129.19, but not the RM4-4 clone.

940108 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940108 Rev.2
Citations & References
Down Arrow

Development References (9)

  1. Bendelac A. Mouse NK1+ T cells. Curr Opin Immunol. 1995; 7(3):367-374. (Biology). View Reference
  2. Bierer BE, Sleckman BP, Ratnofsky SE, Burakoff SJ. The biologic roles of CD2, CD4, and CD8 in T-cell activation. Annu Rev Immunol. 1989; 7:579-599. (Biology). View Reference
  3. Bosselut R, Zhang W, Ashe JM, Kopacz JL, Samelson LE, Singer A. Association of the adaptor molecule LAT with CD4 and CD8 coreceptors identifies a new coreceptor function in T cell receptor signal transduction. J Exp Med. 1999; 190(10):1517-1526. (Biology). View Reference
  4. Godfrey DI, Kennedy J, Mombaerts P, Tonegawa S, Zlotnik A. Onset of TCR-β gene rearrangement and role of TCR-β expression during CD3-CD4-CD8- thymocyte differentiation. J Immunol. 1994; 152(10):4783-4792. (Clone-specific: Flow cytometry). View Reference
  5. Nakamura T. Personal Communication. .
  6. Tanaka T, Tsudo M, Karasuyama H, et al. A novel monoclonal antibody against murine IL-2 receptor beta-chain. Characterization of receptor expression in normal lymphoid cells and EL-4 cells. J Immunol. 1991; 147(7):2222-2228. (Clone-specific: Flow cytometry). View Reference
  7. Wineman JP, Gilmore GL, Gritzmacher C, Torbett BE, Muller-Sieburg CE. CD4 is expressed on murine pluripotent hematopoietic stem cells. Blood. 1992; 180(7):1717-1724. (Biology). View Reference
  8. Wu L, Antica M, Johnson GR, Scollay R, Shortman K. Developmental potential of the earliest precursor cells from the adult mouse thymus. J Exp Med. 1991; 174(6):1617-1627. (Biology). View Reference
  9. Wu L, Scollay R, Egerton M, Pearse M, Spangrude GJ, Shortman K. CD4 expressed on earliest T-lineage precursor cells in the adult murine thymus. Nature. 1991; 349(6304):71-74. (Biology). View Reference
View All (9) View Less
940108 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.