Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD184

BD™ AbSeq Oligo Rat Anti-Mouse CD184

Clone 2B11/CXCR4 (RUO)

Sign In
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CXCR4, C-X-C chemokine receptor type 4; Fusin; LESTR; PB-CKR; Sdf1r
12767
2 µl
Rat IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTGGTAATAAGGTGAATAGGTCGCGAGAAGTAAGT
AMM2047
GST-NCXCR4 fusion protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940151 Rev. 3
Antibody Details
Down Arrow
2B11/CXCR4

The 2B11/CXCR4 monoclonal antibody specifically binds to mouse CD184, which is also known as the C-X-C Chemokine Receptor type 4 , CXCR4.  CXCR4 (previously known as Fusin and LESTR), is a seven-transmembrane, G-protein-coupled receptor. It is the specific receptor for the CXC chemokine, SDF-1/CXCL12.  Mouse CXCR4 shows 91% homology at the amino acid level with human CXCR4. CXCR4 is widely expressed by hematopoietic and non-hematopoietic cell types including neutrophils, monocytes, T cells, B cells, CD34-positive progenitor cells, endothelial cells, neurons and astrocytes.  Human CXCR4 is used by T-tropic HIV-1 as a co-receptor for viral entry.  The mouse Cxcr4 gene has been mapped to chromosome 1.

940151 Rev. 3
Citations & References
Down Arrow

Development References (9)

  1. Bleul CC, Farzan M, Choe H, et al. The lymphocyte chemoattractant SDF-1 is a ligand for LESTR/fusin and blocks HIV-1 entry. Nature. 1996; 382(6594):829-833. (Biology). View Reference
  2. Bleul CC, Wu L, Hoxie JA, Springer TA, Mackay CR. The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes.. Proc Natl Acad Sci U S A. 1997; 94(5):1925-1930. (Biology). View Reference
  3. Feng Y, Broder CC, Kennedy PE, Berger EA. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science. 1996; 272(5263):872-877. (Biology). View Reference
  4. Forster R, Kremmer E, Schubel A, et al. Intracellular and surface expression of the HIV-1 coreceptor CXCR4/fusin on various leukocyte subsets: rapid internalization and recycling upon activation. J Immunol. 1998; 160(3):1522-1531. (Immunogen: ELISA, Flow cytometry, Fluorescence microscopy, Functional assay, Inhibition, Western blot). View Reference
  5. Gupta SK, Lysko PG, Pillarisetti K, Ohlstein E, Stadel JM. Chemokine receptors in human endothelial cells. Functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J Biol Chem. 1998; 273(7):4282-4287. (Biology). View Reference
  6. Heesen M, Berman MA, Benson JD, Gerard C, Dorf ME. Cloning of the mouse fusin gene, homologue to a human HIV-1 co-factor. J Immunol. 1996; 157(12):5455-5460. (Biology). View Reference
  7. Hesselgesser J, Halks-Miller M, DelVecchio V, et al. CD4-independent association between HIV-1 gp120 and CXCR4: functional chemokine receptors are expressed in human neurons. Curr Biol. 1997; 7(2):112-121. (Biology). View Reference
  8. Oberlin E, Amara A, Bachelerie F, et al. The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1. Nature. 1996; 382(6594):833-835. (Biology). View Reference
  9. Schabath R, Muller G, Schubel A, Kremmer E, Lipp M, Forster R. The murine chemokine receptor CXCR4 is tightly regulated during T cell development and activation. J Leukoc Biol. 1999; 66(6):996-1004. (Clone-specific: Flow cytometry, Fluorescence microscopy, Immunofluorescence, Western blot). View Reference
View All (9) View Less
940151 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.