Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD272 (BTLA)

BD™ AbSeq Oligo Mouse Anti-Human CD272 (BTLA)

Clone J168-540 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
BTLA1; B- and T-lymphocyte-associated protein
151888
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTAGGTTGATAGTCGGCGATAGTGCGGTTGAAAGCT
AHS0052
Human BTLA Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940105 Rev. 3
Antibody Details
Down Arrow Up Arrow
J168-540

The J168-540 monoclonal antibody specifically binds to human CD272, also known as BTLA (B and T lymphocyte attenuator), an inhibitory receptor expressed in bone marrow and thymus on developing B and T cells. In the periphery, BTLA is expressed by B cells, T cells, bone marrow-derived dendritic cells, and macrophages. After T cell activation, BTLA appears to be expressed at higher levels on Th1 cell populations than in Th2 cell populations. Upon binding the herpesvirus entry mediator (HVEM/LIGHT-R/CD270), CD272 undergoes tyrosine phosphorylation and inhibits T cell proliferation in a BTLA-dependent manner. CD272 has structural similarities to two other lymphocyte inhibitory receptors, CTLA-4 and PD-1 and is a member of the CD28-like family of coreceptors. Based on these observations, CD272 is considered to be a negative regulator of lymphocyte activation and/or function.

940105 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940105 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940105" on CiteAb

Development References (5)

  1. Compaan DM, Gonzalez LC, Tom I, Loyet KM, Eaton D, Hymowitz SG. Attenuating lymphocyte activity: the crystal structure of the BTLA-HVEM complex. J Biol Chem. 2005; 280(47):39553-39561. (Biology). View Reference
  2. Hobo W, Norde WJ, Schaap N, et al. B and T lymphocyte attenuator mediates inhibition of tumor-reactive CD8+ T cells in patients after allogeneic stem cell transplantation. J Immunol. 2012; 189(1):39-49. (Clone-specific: Flow cytometry). View Reference
  3. Llinas L, Lazaro A, de Salort J, Matesanz-Isabel J, Sintes J, Engel P. Expression profiles of novel cell surface molecules on B-cell subsets and plasma cells as analyzed by flow cytometry. Immunol Lett. 2011; 134(2):113-121. (Clone-specific: Flow cytometry). View Reference
  4. Sedy JR, Gavrieli M, Potter KG, et al. B and T lymphocyte attenuator regulates T cell activation through interaction with herpesvirus entry mediator. Nat Immunol. 2005; 6(1):90-98. (Biology). View Reference
  5. Watanabe N, Gavrieli M, Sedy JR, et al. BTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1. Nat Immunol. 2003; 4(7):670-679. (Biology). View Reference
940105 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.