Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse Vγ 2 T-Cell Receptor

BD™ AbSeq Oligo Hamster Anti-Mouse Vγ 2 T-Cell Receptor

Clone UC3-10A6 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
V gamma 2 TCR; Vγ2 TCR; Trgv2
21636
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGAATGTCAGGTTAATAGCGAGAATGGAATAGTGTC
AMM2155
Not Reported
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.
940352 Rev. 2
Antibody Details
Down Arrow Up Arrow
UC3-10A6

The UC3-10A6 monoclonal antibody specifically recognizes T-cell Receptor (TCR) V gamma 2 (Vγ2). Vγ2+ TCRγδ cells make up significant proportions of TCRγδ cells in the late fetal and adult thymus and adult peripheral lymphoid tissues and lung. The frequency of splenic Vγ2+ TCRγδ cells differs among inbred mouse strains; in C57BL/6 mice, the frequency increases dramatically during the four weeks after birth. Immobilized UC3-10A6 antibody can activate Vγ2+ TCRγδ cells. Please note that the Vγ2 designation correlates with the nomenclature of Garman, Doherty, and Raulet; the Vγ4 designation of Heiligand Tonegawa is equilvalent.

940352 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940352 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940352" on CiteAb

Development References (7)

  1. Allison JP, Havran WL. The immunobiology of T cells with invariant gamma delta antigen receptors. Annu Rev Immunol. 1991; 9:679-705. (Biology). View Reference
  2. Dent AL, Matis LA, Hooshmand F, Widacki SM, Bluestone JA, Hedrick SM. Self-reactive gamma delta T cells are eliminated in the thymus. Nature. 1990; 343(6260):714-719. (Biology). View Reference
  3. Houlden BA, Matis LA, Cron RQ, et al. A TCR gamma delta cell recognizing a novel TL-encoded gene product. Cold Spring Harb Symp Quant Biol. 1989; 54(1):45-55. (Biology). View Reference
  4. Kelly KA, Pearse M, Lefrancois L, Scollay R. Emigration of selected subsets of gamma delta + T cells from the adult murine thymus. Int Immunol. 1993; 5(4):331-335. (Biology). View Reference
  5. O'Brien RL, Yin X, Huber SA, Ikuta K, Born WK. Depletion of a gamma delta T cell subset can increase host resistance to a bacterial infection. J Immunol. 2000; 165(11):6472-6479. (Biology). View Reference
  6. Sperling AI, Cron RQ, Decker DC, Stern DA, Bluestone JA. Peripheral T cell receptor gamma delta variable gene repertoire maps to the T cell receptor loci and is influenced by positive selection. J Immunol. 1992; 149(10):3200-3207. (Clone-specific: Flow cytometry). View Reference
  7. Sperling AI, Decker DC, DiPaolo RJ, Stern DA, Shum A, Bluestone JA. Selective expansion of Vgamma2-Vdelta7 TCR gammadelta cells in C57BL/6 mice is postnatal and extrathymic. J Immunol. 1997; 159(1):86-91. (Clone-specific: Flow cytometry). View Reference
View All (7) View Less
940352 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.