Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD25 (IL-2 Receptor a)

BD™ AbSeq Oligo Rat Anti-Mouse CD25 (IL-2 Receptor a)

Clone PC61 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Interleukin-2 receptor alpha chain; IL-2RA; IL-2Rα; Il2ra; IL-2R p55
16184
2 µl
Rat OFA, also known as Outbred OFA IgG1, λ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGAGAATTCCGATGCGCGTGTTAAGTATATAGGTTG
AMM2012
IL-2-dependent cytolytic mouse T-cell clone B6.1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940116 Rev. 2
Antibody Details
Down Arrow Up Arrow
PC61

The PC61 monoclonal antibody specifically binds to CD25, the low-affinity IL-2 Receptor α chain (IL-2Rα, p55) expressed on activated T and B lymphocytes from all mouse strains tested. IL-2Rα by itself is not a signaling receptor. However, it can combine with IL-2 Receptor β (CD122) and γc (CD132) chains to form high-affinity, signaling receptor complexes for IL-2. Resting T and B lymphocytes and resting and activated NK cells do not express IL-2Rα. CD25 is transiently expressed at a low level during normal B-cell development in the bone marrow on the CD45R/B220low TdT- sIg- Pre-B/Pre-B-II and CD45R/B220low TdT- sIgM+ sIgD- immature B stages, but not on the CD45R/B220low TdT+ sIg- Pro-B/Pre-B-I stage nor on CD45R/B220high TdT- sIgM+ sIgD+ mature B cells. It is expressed at a higher level during a very early stage of T-cell development in fetal and adult thymus. Peripheral CD25+CD4+ lymphocytes called regulatory T (Treg) cells are involved in the maintenance of self-tolerance. It has also been reported that dendritic cells express CD25, recognized by mAb 7D4. The PC61 antibody recognizes an epitope of CD25 which is distinct from the IL-2 binding site and from those recognized by mAbs 3C7 and 7D4. It blocks binding of IL-2 to CD25, presumably by inducing a conformational change in CD25.

940116 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940116 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940116" on CiteAb

Development References (9)

  1. Ceredig R, Lowenthal JW, Nabholz M, MacDonald HR. Expression of interleukin-2 receptors as a differentiation marker on intrathymic stem cells. Nature. 1985; 314(6006):98-100. (Clone-specific: Blocking, Immunohistochemistry). View Reference
  2. Chen J, Ma A, Young F, Alt FW. IL-2 receptor alpha chain expression during early B lymphocyte differentiation. Int Immunol. 1994; 6(8):1265-1268. (Biology). View Reference
  3. Ernst DN, Weigle WO, McQuitty DN, Rothermel AL, Hobbs MV. Stimulation of murine T cell subsets with anti-CD3 antibody. Age-related defects in the expression of early activation molecules. J Immunol. 1989; 142(5):1413-1421. (Clone-specific: Flow cytometry). View Reference
  4. Garni-Wagner BA, Witte PL, Tutt MM, et al. Natural killer cells in the thymus. Studies in mice with severe combined immune deficiency. J Immunol. 1990; 144(3):796-803. (Biology). View Reference
  5. Godfrey DI, Zlotnik A. Control points in early T-cell development. Immunol Today. 1993; 14(11):547-553. (Biology). View Reference
  6. Lowenthal JW, Corthésy P, Tougne C, Lees R, MacDonald HR, Nabholz M. High and low affinity IL 2 receptors: analysis by IL 2 dissociation rate and reactivity with monoclonal anti-receptor antibody PC61. J Immunol. 1985; 135(6):3988-3994. (Immunogen: Bioassay, Blocking, Functional assay, Inhibition, Radioimmunoassay). View Reference
  7. Lowenthal JW, Zubler RH, Nabholz M, MacDonald HR. Similarities between interleukin-2 receptor number and affinity on activated B and T lymphocytes. Nature. 1985; 315(6021):669-672. (Clone-specific: Blocking, Immunoprecipitation, Radioimmunoassay). View Reference
  8. Moreau JL, Nabholz M, Diamantstein T, Malek T, Shevach E, Theze J. Monoclonal antibodies identify three epitope clusters on the mouse p55 subunit of the interleukin 2 receptor: relationship to the interleukin 2-binding site. Eur J Immunol. 1987; 17(7):929-935. (Clone-specific: Blocking). View Reference
  9. Read S, Malmstrom V, Powrie F. Cytotoxic T lymphocyte-associated antigen 4 plays an essential role in the function of CD25(+)CD4(+) regulatory cells that control intestinal inflammation. J Exp Med. 2000; 192(2):295-302. (Biology). View Reference
View All (9) View Less
940116 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.