Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD1d

BD™ AbSeq Oligo Rat Anti-Mouse CD1d

Clone 1B1 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Cd1d1; Cd1.1; Cd1a; Cd1d; Ly-38
12479
2 µl
Rat LEW, also known as Lewis IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGAGCGGTAGGTTAGTAAATCGGTATGTGGAAGTC
AMM2067
Mouse Cd1.1 cDNA-transfected RMA-S mouse T lymphoma and L929 cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940171 Rev. 3
Antibody Details
Down Arrow Up Arrow
1B1

The 1B1 monoclonal antibody specifically binds to mouse CD1d, a 48-kDa glycoprotein with structural homology to major histocompatibility complex (MHC) class I molecules. The structure, expression, and functions of CD1 antigens are complex and have been reviewed. MAb 1B1 detects CD1d at varying levels on most types of bone marrow and peripheral leukocytes and on epithelial, dendritic, and lymphoid cells in the thymus. It appears to recognize CD1d only in association with β2m. CD1d has been reported to be expressed by gastrointestinal tract epithelium and in the cytoplasm of hepatocytes via immunohistochemical staining of frozen sections with mAb 3C11 (Cat. No. 559871, for the purified antibody), suggesting a possible role for CD1d in mucosal immunity. However, CD1d expression was not detectable via flow cytometry on intestinal epithelial cells in studies using the anti-CD1d mAbs 3C11, 1B1, and 9C7. The 1B1 antibody competes with mAb 3C11 in binding to mouse splenocytes.  

940171 Rev. 3
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940171 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940171" on CiteAb

Development References (10)

  1. Abrams J. Immunoenzymetric assay of mouse and human cytokines using NIP-labeled anti-cytokine antibodies. Curr Protoc Immunol. 2001; 1:6.20-6.21. (Clone-specific: ELISA). View Reference
  2. Assenmacher M, Schmitz J, Radbruch A. Flow cytometric determination of cytokines in activated murine T helper lymphocytes: expression of interleukin-10 in interferon-gamma and in interleukin-4-expressing cells. Eur J Immunol. 1994; 24(5):1097-1101. (Clone-specific: Flow cytometry). View Reference
  3. Haak-Frendscho M, Brown JF, Iizawa Y, Wagner RD, Czuprynski CJ. Administration of anti-IL-4 monoclonal antibody 11B11 increases the resistance of mice to Listeria monocytogenes infection. J Immunol. 1992; 148(12):3978-3985. (Clone-specific: Functional assay, Neutralization). View Reference
  4. Lindqvist C, Lundstrom H, Oker-Blom C, Akerman KE. Enhanced IL-4-mediated D10.G4.1 proliferation with suboptimal concentrations of anti-IL-4 receptor monoclonal antibodies. J Immunol. 1993; 150(2):394-398. (Clone-specific: Functional assay, Neutralization). View Reference
  5. Ohara J, Paul WE. Production of a monoclonal antibody to and molecular characterization of B-cell stimulatory factor-1. Nature. 1985; 315(6017):333-336. (Immunogen). View Reference
  6. Openshaw P, Murphy EE, Hosken NA, et al. Heterogeneity of intracellular cytokine synthesis at the single-cell level in polarized T helper 1 and T helper 2 populations. J Exp Med. 1995; 182(5):1357-1367. (Clone-specific: Flow cytometry). View Reference
  7. Prussin C, Metcalfe DD. Detection of intracytoplasmic cytokine using flow cytometry and directly conjugated anti-cytokine antibodies. J Immunol Methods. 1995; 188(1):117-128. (Methodology: Flow cytometry, IC/FCM Block). View Reference
  8. Sadick MD, Heinzel FP, Holaday BJ, Pu RT, Dawkins RS, Locksley RM. Cure of murine leishmaniasis with anti-interleukin 4 monoclonal antibody. Evidence for a T cell-dependent, interferon gamma-independent mechanism. J Exp Med. 1990; 171(1):115-127. (Clone-specific: Functional assay, Neutralization). View Reference
  9. Sander B, Hoiden I, Andersson U, Moller E, Abrams JS. Similar frequencies and kinetics of cytokine producing cells in murine peripheral blood and spleen. Cytokine detection by immunoassay and intracellular immunostaining. J Immunol Methods. 1993; 166(2):201-214. (Clone-specific: ELISA, Flow cytometry). View Reference
  10. Swain SL, Weinberg AD, English M, Huston G. IL-4 directs the development of Th2-like helper effectors. J Immunol. 1990; 145(11):3796-3806. (Clone-specific: Functional assay, Neutralization). View Reference
View All (10) View Less
940171 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.