Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD85k

BD™ AbSeq Oligo Mouse Anti-Human CD85k

Clone ZM3.8 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
LILRB4; ILT-3; HM18; LIRB4; LIR-5
11006
2 µl
Mouse BALB/c IgG1
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTAGTCGTAGTTGGCGTGAATTGGGCTTATATCTG
AHS0179
Human ILT3 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940261 Rev. 2
Antibody Details
Down Arrow Up Arrow
ZM3.8

The ZM3.8 monoclonal antibody specifically binds to CD85k which is also known as Immunoglobulin-like transcript 3 (ILT-3) and Monocyte inhibitory receptor HM18. CD85k is encoded by LILRB4 (Leukocyte immunoglobulin-like receptor, subfamily B member 4) and is expressed as a type I transmembrane glycoprotein. CD85k is comprised of two C2-type Ig domains, a transmembrane region, and a cytoplasmic tail with three immunoreceptor tyrosine-based inhibitory motifs (ITIMs). CD85k is selectively expressed by myeloid antigen presenting cells including monocytes, macrophages, and dendritic cells. CD85k functions as an inhibitory receptor. ILT3 can also function in antigen capture and presentation. It is efficiently internalized upon cross-linking, and delivers its ligand to an intracellular compartment where it is processed and ultimately presented by APCs to T cells. Thus, ILT3 is a novel inhibitory receptor that can negatively regulate activation of APCs and can be used by APCs for antigen uptake. ILT3 expression is upregulated on tolerogenic dendritic cells that can induce regulatory T cells.

940261 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940261 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940261" on CiteAb

Development References (7)

  1. Cella M, Dohring C, Samaridis J, et al. A novel inhibitory receptor (ILT3) expressed on monocytes, macrophages, and dendritic cells involved in antigen processing. J Exp Med. 1997; 185:1743-1751. (Immunogen: ELISA, Flow cytometry, Functional assay, Immunoprecipitation). View Reference
  2. Dobrowolska H, Gill KZ, Serban G, et al. Expression of immune inhibitory receptor ILT3 in acute myeloid leukemia with monocytic differentiation. Cytometry. 2013; 84(1):21-29. (Biology). View Reference
  3. Kim-Schulze S, Seki T, Vlad G, et al. Regulation of ILT3 gene expression by processing of precursor transcripts in human endothelial cells. Transplantation. 2006; 6(1):76-82. (Biology). View Reference
  4. Mori Y, Tsuji S, Inui M, et al. J Immunol. 2008; 181(7):4742-4751. (Clone-specific: Flow cytometry, Fluorescence microscopy, Functional assay, Immunofluorescence). View Reference
  5. Penna G, Roncari A, Amuchastegui S, et al. Expression of the inhibitory receptor ILT3 on dendritic cells is dispensable for induction of CD4+Foxp3+ regulatory T cells by 1,25-dihydroxyvitamin D3. Blood. 2005; 106(10):3490-3497. (Biology). View Reference
  6. Vlad G, Cortesini R, Suciu-Foca N. CD8+ T suppressor cells and the ILT3 master switch. Hum Immunol. 2008; 69(11):681-686. (Biology). View Reference
  7. Zola H, Swart B, Boumsell L, Mason DY. Human Leucocyte Differentiation Antigen nomenclature: update on CD nomenclature. Report of IUIS/WHO Subcommittee.. J Immunol Methods. 2003; 275(1-2):1-8. (Clone-specific: Flow cytometry). View Reference
View All (7) View Less
940261 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.