Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD28

BD™ AbSeq Oligo Mouse Anti-Human CD28

Clone L293 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD28 antigen; T44; Tp44; TP44; Leu28
940
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTTGAGGATACGATGAAGCGGTTTAAGGGTGTGG
AHS0138
HPB-ALL T cell line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940226 Rev. 2
Antibody Details
Down Arrow Up Arrow
L293

The L293 monoclonal antibody specifically binds to CD28 which is also known as Tp44 or T44. The CD28 antigen is a 44 kDa homodimeric type I transmembrane glycoprotein which is present on most mature T cells, thymocytes, and plasma cells. CD28 is a cell-adhesion molecule (CAM) that functions as a receptor for CD80 (B7-1) and CD86 (B7-2) antigens, which are present on activated B lymphocytes, monocytes, and dendritic cells. Interaction of the CD28 antigen with CD80 or CD86 antigens, or both, co-stimulates CD2 and CD3 antigen/T-cell antigen receptor (TCR)-dependent T-cell-mediated proliferation and cytotoxicity. The L293 antibody has been demonstrated to bind to the same molecule as clone CD28.2, another CD28-specific antibody.

940226 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940226 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940226" on CiteAb

Development References (2)

  1. Azuma M, Cayabyab M, Buck D, Phillips JH, Lanier LL. CD28 interaction with B7 costimulates primary allogeneic proliferative responses and cytotoxicity mediated by small, resting T lymphocytes.. J Exp Med. 1992; 175(2):353-60. (Immunogen: Flow cytometry, Functional assay, Inhibition). View Reference
  2. Azuma M, Phillips JH, Lanier LL. CD28- T lymphocytes. Antigenic and functional properties.. J Immunol. 1993; 150(4):1147-59. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
940226 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.