Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD3e

BD™ AbSeq Oligo Hamster Anti-Mouse CD3e

Clone 500A2 (RUO)

940171
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CD3; CD3 epsilon; Cd3e; CD3ε; T3e
12501
2 µl
Syrian Hamster IgG2, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGCGGTCAGGTAGGGTGTTGTAATTAATCGTATCTT
AMM2111
Mouse T-cell receptor
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Syrian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940327 Rev. 2
Antibody Details
Down Arrow
500A2

The 500A2 monoclonal antibody specifically binds to the 25-kDa ε chain of the T-cell receptor-associated CD3 complex expressed on mouse thymocytes, mature T lymphocytes, and NKT cells. Plate-bound and soluble forms of the 500A2 antibody can activate T cells in vitro. Activation of a mouse T-cell clone by the 500A2 antibody can be blocked by Fab fragments of the GK1.5 anti-CD4 antibody. This suggests that the 500A2 antibody may bind an epitope on CD3e close to a site at which CD4 associates with the T-cell receptor. The 500A2 antibody reportedly does not to crossreact with rat leukocytes.

940327 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940327 Rev.2
Citations & References
Down Arrow

Development References (5)

  1. Allison JP, Havran WL, Poenie M, et al. Expression and function of CD3 on murine thymocytes. In: Kappler J, Davis M, ed. The T-Cell Receptor, UCLA Symposia, 73rd Edition. Los Angeles: 1988:33-45.
  2. Havran WL, Poenie M, Kimura J, Tsien R, Weiss A, Allison JP. Expression and function of the CD3-antigen receptor on murine CD4+8+ thymocytes. Nature. 1987; 330(6144):170-173. (Clone-specific). View Reference
  3. Kubo RT, Born W, Kappler JW, Marrack P, Pigeon M. Characterization of a monoclonal antibody which detects all murine alpha beta T cell receptors. J Immunol. 1989; 142(8):2736-2742. (Methodology). View Reference
  4. Ortaldo JR, Winkler-Pickett R, Mason AT, Mason LH. The Ly-49 family: regulation of cytotoxicity and cytokine production in murine CD3+ cells. J Immunol. 1998; 160(1):1158-1165. (Clone-specific). View Reference
  5. Portoles P, Rojo J, Golby A, et al . Monoclonal antibodies to murine CD3 epsilon define distinct epitopes, one of which may interact with CD4 during T cell activation. J Immunol. 1989; 142(12):4169-4175. (Clone-specific). View Reference
940327 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.