Skip to main content Skip to navigation
Oligo Mouse Anti-Mouse β2-Microglobulin [b,c]

BD™ AbSeq Oligo Mouse Anti-Mouse β2-Microglobulin [b,c]

Clone S19.8 (RUO)

653179
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Ly-m11; beta-2 microglobulin; B2m; beta2m; beta2-m
12010
2 µl
Mouse SJL IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CCGTCGAAGGGAGGATAGTATGATTGGTGTAAGTCT
AMM2194
B10.S Mouse Spleen Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940434 Rev. 2
Antibody Details
Down Arrow
S19.8

The s19.8 monoclonal antibody specifically recognizes the b and c alloantigens of β2 microglobulin, originally designated Ly-m11. β2 microglobulin is a 12 kDa protein, homologous to a single immunoglobulin constant-region domain, which is noncovalently associated with the MHC class I heavy chain. It may also associate noncovalently with CD1d in some cells types. Positive strains include C57BL/6, C57BL/10, C57BR, and C57L; whereas, A, AKR, BALB/c, C58, C3H, CBA, DBA/1, DBA/2, SJL, SWR, and 129 strains are negative.

940434 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940434 Rev.2
Citations & References
Down Arrow

Development References (5)

  1. Jullien D, Brossay L, Sieling PA, Modlin RL, Kronenberg M. CD1: clues on a new antigen-presenting pathway. Res Immunol. 1996; 147(5):321-328. (Biology). View Reference
  2. Kurtz ME, Graff RJ, Adelman A, Martin-Morgan D, Click RE. CTL and serologically defined antigens of B2m,H-3 region. J Immunol. 1985; 135(4):2847-2852. (Clone-specific: Cytotoxicity). View Reference
  3. Mouse Genome Database (MGD), Mouse Genome Informatics, The Jackson Laboratory. B2m, beta-2 microglobulin. Available: http://www.informatics.jax.org 4/15/1998.
  4. Pérarnau B, Saron MF, Reina San Martin B, et al. Single H2Kb, H2Db and double H2KbDb knockout mice: peripheral CD8+ T cell repertoire and anti-lymphocytic choriomeningitis virus cytolytic responses.. Eur J Immunol. 1999; 29(4):1243-52. (Clone-specific: Immunofluorescence). View Reference
  5. Tada N, Kimura S, Hatzfeld A, Hammerling U. Ly-m11: the H-3 region of mouse chromosome 2 controls a new surface alloantigen. Immunogenetics. 1980; 11(5):441-449. (Immunogen). View Reference
940434 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.