Skip to main content Skip to navigation
Oligo Mouse Anti-Human Her2/Neu

BD™ AbSeq Oligo Mouse Anti-Human Her2/Neu

Clone NEU 24.7 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
HER2; NEU; ERBB2; p185HER2; erb-b2 receptor tyrosine kinase 2; CD340
2064
2 µl
Mouse BALB/c IgG1
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTGTCTCGGTGGTATTAGTAGCTCGCGTATTATCT
AHS0152
SKBR3 human breast carcinoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940238 Rev. 2
Antibody Details
Down Arrow Up Arrow
NEU 24.7

The Neu 24.7 monoclonal antibody specifically recognizes HER-2/neu, which is also known as p185HER2 or CD340. HER-2/neu is a ~185 kDa type I transmembrane glycoprotein that is encoded by ERBB2 (erb-b2 receptor tyrosine kinase 2) which belongs to the ERBB receptor kinase family. The HER-2/neu antigen is expressed on some breast cancer cells. Amplification and/or over expression of HER-2/neu occurs in multiple human malignancies. Overexpression is reported to be strongly correlated with progression of human ovarian and breast carcinomas. Anti-HER-2/neu stains the external domain of this protein on cells such as the strongly expressing line SKBR3 and the weakly expressing line MCF7. HER-2/neu is also expressed on normal bone marrow mesenchymal stem cells (MSC).

940238 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940238" on CiteAb

Development References (5)

  1. Fendly BM, Kotts C, Vetterlein D, et al. The extracellular domain of HER2/neu is a potential immunogen for active specific immunotherapy of breast cancer.. J Biol Response Mod. 1990; 9(5):449-55. (Biology). View Reference
  2. Gullick WJ. The role of the epidermal growth factor receptor and the c-erbB-2 protein in breast cancer.. Int J Cancer Suppl. 1990; 5:55-61. (Biology). View Reference
  3. Shalaby MR, Shepard HM, Presta L, et al. Development of humanized bispecific antibodies reactive with cytotoxic lymphocytes and tumor cells overexpressing the HER2 protooncogene.. J Exp Med. 1992; 175(1):217-25. (Biology). View Reference
  4. Stancovski I, Hurwitz E, Leitner O, Ullrich A, Yarden Y, Sela M. Mechanistic aspects of the opposing effects of monoclonal antibodies to the ERBB2 receptor on tumor growth.. Proc Natl Acad Sci USA. 1991; 88(19):8691-5. (Immunogen: Immunoprecipitation, Radioimmunoassay). View Reference
  5. Szollosi J, Balazs M, Feuerstein BG, Benz CC, Waldman FM. ERBB-2 (HER2/neu) gene copy number, p185HER-2 overexpression, and intratumor heterogeneity in human breast cancer. Cancer Res. 1995; 55(22):5400-5407. (Biology). View Reference
940238 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.