Skip to main content Skip to navigation
Oligo Mouse Anti-Human GARP

BD™ AbSeq Oligo Mouse Anti-Human GARP

Clone 7B11 (also known as CMSSC-7B11) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
LRRC32; Garpin; Glycoprotein A repetitions predominant
2 µl
Mouse IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CAATAGTGCCGTTAAGCGTAGTGGAGTAGACCGAGT
AHS0126
Recombinant Human LRRC32
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940217 Rev. 2
Antibody Details
Down Arrow Up Arrow
7B11

The 7B11 (also known as CMSSC-7B11) monoclonal antibody specifically binds to human GARP (Glycoprotein A repetitions predominant). The LRRC32 (Leucine rich repeat containing 32) gene encodes the 662 amino acid-residue, 80 kDa transmembrane GARP glycoprotein that has an extracellular region composed primarily of 20 leucine-rich repeats. GARP is specifically expressed on Treg cells activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in naïve T cells induced expression of FoxP3 and endowed them with a partial suppressive function. The extracellular, but not the cytoplasmic region, of GARP was necessary for these functions. GARP serves as a receptor for latent TGF-beta which may play a role in the suppressive action of Treg cells. GARP is also expressed on platelets and other tissues, however the function on these cells is not known.

940217 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940217" on CiteAb

Development References (3)

  1. Ollendorff V, Noguchi T, deLapeyriere O, Birnbaum D. The GARP gene encodes a new member of the family of leucine-rich repeat-containing proteins. Cell Growth Differ. 1994; 5(2):213-219. (Biology). View Reference
  2. Sivanathan KN, Rojas-Canales DM, Hope CM, et al. Interleukin-17A-Induced Human Mesenchymal Stem Cells Are Superior Modulators of Immunological Function.. Stem Cells. 2015; 33(9):2850-63. (Clone-specific: Flow cytometry). View Reference
  3. Stockis J, Colau D, Coulie PG, Lucas S. Membrane protein GARP is a receptor for latent TGF-beta on the surface of activated human Treg. Eur J Immunol. 2009; 39(12):3315-3322. (Biology). View Reference
940217 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.