Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD324 (E-Cadherin)

BD™ AbSeq Oligo Mouse Anti-Human CD324 (E-Cadherin)

Clone 67A4

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
E-cadherin; CD324; CDH1; CADH1; Cadherin-1; ECAD; CDHE; Arc-1; LCAM; UVO
999
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GATATGAATGGGTTGCGGTGTAAAGTCGTAATGGTT
AHS0041
Human Breast Tumor Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940210 Rev. 2
Antibody Details
Down Arrow Up Arrow
67A4

The 67A4 monoclonal antibody specifically recognizes the extracellular domain of human E-Cadherin (CD324). E-Cadherin is a 120-kDa transmembrane glycoprotein that is localized in the adherens junctions of epithelial cells. There it interacts with the cytoskeleton through the associated cytoplasmic catenin proteins.  In addition to being a calcium-dependent adhesion molecule, E-Cadherin is also a critical regulator of epithelial junction formation. Its association with catenins is necessary for cell-to-cell adhesion. These E-Cadherin/catenin complexes associate with cortical actin bundles at both the zonula adherens and the lateral adhesion plaques.  Tyrosine phosphorylation can disrupt these complexes, leading to changes in cell adhesion properties. E-Cadherin expression is often down-regulated in highly invasive, poorly differentiated carcinomas. Increased expression of E-Cadherin in these cells reduces their invasiveness. Thus, loss of expression or function of E-Cadherin appears to be an important step in tumorigenic progression. Pluripotent stem cells express E-Cadherin. Upon differentiation, an epithelial to mesenchymal transition results in the loss of E-cadherin expression and a gain in the expression of N-cadherin.

940210 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940210 Rev.2
Citations & References
Down Arrow Up Arrow

Development References (6)

  1. Behrens J, Vakaet L, Friis R, et al. Loss of epithelial differentiation and gain of invasiveness correlates with tyrosine phosphorylation of the E-cadherin/beta-catenin complex in cells transformed with a temperature-sensitive v-SRC gene.. J Cell Biol. 1993; 120(3):757-66. (Biology). View Reference
  2. Bühring HJ, Müller T, Herbst R, et al. The adhesion molecule E-cadherin and a surface antigen recognized by the antibody 9C4 are selectively expressed on erythroid cells of defined maturational stages.. Leukemia. 1996; 10(1):106-16. (Clone-specific: Flow cytometry). View Reference
  3. Cepek KL, Shaw SK, Parker CM, et al. Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and the alpha E beta 7 integrin.. Nature. 1994; 372(6502):190-3. (Biology). View Reference
  4. D'Amour KA, Agulnick AD, Eliazer S, Kelly OG, Kroon E, Baetge EE. Efficient differentiation of human embryonic stem cells to definitive endoderm.. Nat Biotechnol. 2005; 23(12):1534-41. (Biology). View Reference
  5. Florian S, Sonneck K, Czerny M, et al. Detection of novel leukocyte differentiation antigens on basophils and mast cells by HLDA8 antibodies. Allergy. 2006; 61(9):1054-1062. (Clone-specific: Flow cytometry). View Reference
  6. Takeichi M. The cadherins: cell-cell adhesion molecules controlling animal morphogenesis.. Development. 1988; 102(4):639-55. (Biology). View Reference
View All (6) View Less
940210 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.