Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD79b

BD™ AbSeq Oligo Mouse Anti-Human CD79b

Clone 3A2-2E7 (also known as SN8) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
Igβ; B29; IGB; AGM6; CD79B
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CTGTCAGTAATAGGGAATCGGTAGGCGTGTAAAGCT
AHS0259
Cell membranes from human B-prol ymphocytic leukemia (B-PLL) cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940381 Rev. 2
Antibody Details
Down Arrow Up Arrow
3A2-2E7

The 3A2-2E7 monoclonal antibody (also known as SN8) specifically recognizes CD79b. Immunoglobulin (Ig) antigen receptors are composed of a non-covalently-associated complex of Ig and two other proteins, Igα and Igβ, clustered as CD79a and CD79b, respectively. CD79b is a membrane glycoprotein of 229 residues, with a predicted relative molecular mass of 36-40 kDa. Its expression is restricted to B lineage cells. CD79b reportedly associates with surface IgM and is involved in signal transduction. The 3A2-2E7 antibody has similar reactivity characteristics as clone CB3-1. The 3A2-2E7 and CD3-1 antibodies specifically react with an epitope that is enhanced on certain B-cell leukemias such as prolymphocytic leukemia and lymphoma, but not on chronic lymphocytic leukemia.

940381 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940381 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940381" on CiteAb

Development References (6)

  1. Engel P, Wagner N, Tedder TF. CD79 Workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:667-670.
  2. Moreau EJ, Matutes E, A'Hern RP, et al. Improvement of the chronic lymphocytic leukemia scoring system with the monoclonal antibody SN8 (CD79b). Am J Clin Pathol. 1997; 108(4):378-382. (Clone-specific: Flow cytometry). View Reference
  3. Okazaki M, Luo Y, Han T, Yoshida M, Seon BK. Three new monoclonal antibodies that define a unique antigen associated with prolymphocytic leukemia/non-Hodgkin's lymphoma and are effectively internalized after binding to the cell surface antigen. Blood. 1993; 81(1):84-94. (Immunogen: Flow cytometry, Immunoprecipitation, Radioimmunoassay). View Reference
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Van Kooten C, Galibert L, Seon BK, Garrone P, Liu YJ, Banchereau J. Cross-linking of antigen receptor via Ig-beta (B29, CD79b) can induce both positive and negative signals in CD40-activated human B cells. Clin Exp Immunol. 1997; 110(3):509-515. (Clone-specific: Flow cytometry, Functional assay). View Reference
  6. Zomas AP, Matutes E, Morilla R, Owusu-Ankomah K, Seon BK, Catovsky D. Expression of the immunoglobulin-associated protein B29 in B cell disorders with the monoclonal antibody SN8 (CD79b). Leukemia. 1996; 10(12):1966-1970. (Clone-specific: Flow cytometry). View Reference
View All (6) View Less
940381 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.