Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD16/CD32

BD™ AbSeq Oligo Rat Anti-Mouse CD16/CD32

Clone 2.4G2 (RUO)

940109
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
FcγRIII/FcγRII; Fcgr3/Fcgr2
2 µl
Rat SD, also known as Sprague-Dawley (outbred) IgG2b, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTTGAGATATGCGTTTAGAGTAGCGTGAGTTAGACC
AMM2003
Mouse BALB/c Macrophage J774
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940109 Rev. 2
Antibody Details
Down Arrow
2.4G2

The 2.4G2 antibody specifically recognizes a common nonpolymorphic epitope on the extracellular domains of the mouse FcγIII (CD16) and FcγII (CD32) Receptors. It has also been reported to bind the FcγI receptor (CD64) via its Fc domain. 2.4G2 mAb blocks non-antigen-specific binding of immunoglobulins to the FcγIII and FcγII, and possibly FcγI, Receptors in vitro and in vivo. CD16 and/or CD32 are expressed on natural killer cells, monocytes, macrophages, dendritic cells (at low levels), Kupffer cells, granulocytes, mast cells, B lymphocytes, immature thymocytes, and some activated mature T lymphocytes.

940109 Rev. 2
Citations & References
Down Arrow

Development References (7)

  1. Araujo-Jorge T, Rivera MT, el Bouhdidi A, Daeron M, Carlier Y. An Fc gamma RII-, Fc gamma RIII-specific monoclonal antibody (2.4G2) decreases acute Trypanosoma cruzi infection in mice. Infect Immun. 1993; 61(11):4925-4928. (Clone-specific: Flow cytometry, Functional assay, In vivo exacerbation). View Reference
  2. Kurlander RJ, Ellison DM, Hall J. The blockade of Fc receptor-mediated clearance of immune complexes in vivo by a monoclonal antibody (2.4G2) directed against Fc receptors on murine leukocytes. J Immunol. 1984; 133(2):855-862. (Clone-specific: Functional assay, In vivo exacerbation, Radioimmunoassay). View Reference
  3. Latour S, Bonnerot C, Fridman WH, Daeron M. Induction of tumor necrosis factor-alpha production by mast cells via Fc gamma R. Role of the Fc gamma RIII gamma subunit. J Immunol. 1992; 149(6):2155-2162. (Clone-specific: Flow cytometry, Functional assay, Stimulation). View Reference
  4. Maeda K, Burton GF, Padgett DA, et al. Murine follicular dendritic cells and low affinity Fc receptors for IgE (Fc epsilon RII). J Immunol. 1992; 148(8):2340-2347. (Clone-specific: Immunohistochemistry). View Reference
  5. Mellman IS, Unkeless JC. Purificaton of a functional mouse Fc receptor through the use of a monoclonal antibody. J Exp Med. 1980; 152(4):1048-1069. (Clone-specific: Immunoaffinity chromatography, Immunoprecipitation, Radioimmunoassay). View Reference
  6. Titus JA, Finkelman FD, Stephany DA, Jones JF, Segal DM. Quantitative analysis of Fc gamma receptors on murine spleen cell populations by using dual parameter flow cytometry. J Immunol. 1984; 133(2):556-561. (Clone-specific: Flow cytometry). View Reference
  7. Unkeless JC. Characterization of a monoclonal antibody directed against mouse macrophage and lymphocyte Fc receptors. J Exp Med. 1979; 150(3):580-596. (Immunogen: Fluorescence microscopy, Immunofluorescence, Inhibition, Radioimmunoassay). View Reference
View All (7) View Less
940109 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.