Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Ig, λ1, λ2 & λ3 Light Chain

BD™ AbSeq Oligo Rat Anti-Mouse Ig, λ1, λ2 & λ3 Light Chain

Clone R26-46

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Igl; Ig λ; Immunoglobulin lambda chain complex; Ig λ1/λ2/λ3
2 µl
Rat IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGGGCATTGGGAGCGGATAGTTGAAAGGTAGTTGT
AMM2233
Pooled Mouse Ig
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940454 Rev. 2
Antibody Details
Down Arrow Up Arrow
R26-46

The R26-46 antibody reacts specifically with mouse Igs bearing λ1, λ2, or λ3 light chains. It does not react with κ light chain or heavy chain. Detection of surface immunoglobulin on Ig λ chain-secreting hybridoma cells has been demonstrated with R26-46 mAb.

940454 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940454 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940454" on CiteAb

Development References (2)

  1. Li Y, Li H, Weigert M. Autoreactive B cells in the marginal zone that express dual receptors.. J Exp Med. 2002; 195(2):181-8. (Clone-specific: Flow cytometry). View Reference
  2. Rolink AG, Winkler T, Melchers F, Andersson J. Precursor B cell receptor-dependent B cell proliferation and differentiation does not require the bone marrow or fetal liver environment.. J Exp Med. 2000; 191(1):23-32. (Clone-specific: Flow cytometry). View Reference
940454 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.