Skip to main content Skip to navigation
Oligo Mouse Anti-Human HLA-DR

BD™ AbSeq Oligo Mouse Anti-Human HLA-DR

Clone G46-6 (also known as L243) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
MHC class II antigen; HLA class II histocompatibility antigen
3122, 3123, 3125, 3126, 3127
2 µl
Mouse IgG2a, κ
Human, Rhesus, Cynomolgus, Baboon (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG
AHS0035
Human lymphoblastoid B-cell line RPMI 8866
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Species cross-reactivity detected in product development may not have been confirmed on every format and/or application.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Illumina is a trademark of Illumina, Inc.
  9. For U.S. patents that may apply, see bd.com/patents.
940010 Rev. 4
Antibody Details
Down Arrow Up Arrow
G46-6

The G46-6 monoclonal antibody specifically binds to HLA-DR, a major histocompatibility complex (MHC) class II antigen. HLA-DR antigens are encoded by genes within the Human Leukocyte Antigen (HLA) Complex located on chromosome 6. HLA-DR is a transmembrane heterodimeric glycoprotein composed of an α chain (36 kDa) and a β subunit (27 kDa) expressed primarily on antigen presenting cells: B cells, dendritic cells, monocytes, macrophages, and thymic epithelial cells. HLA-DR is also expressed on activated T cells. This molecule plays a major role in mediating cellular interactions during antigen presentation to CD4-positive T cells.

940010 Rev. 4
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940010 Rev.4
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940010" on CiteAb

Development References (9)

  1. Baracho GV, Kara N, Rigaud S, Lo E, Widmann SJ, Tyznik AJ. Functional phenotyping of circulating human cytotoxic T cells and NK cells using a 16-color flow cytometry panel.. STAR Protoc. 2022; 3(1):101069. (Clone-specific: Cytotoxicity, Flow cytometry, Functional assay). View Reference
  2. Dieckmann D, Plottner H, Berchtold S, Berger T, Schuler G. Ex vivo isolation and characterization of CD4(+)CD25(+) T cells with regulatory properties from human blood. J Exp Med. 2001; 193(11):1303-1310. (Clone-specific: Flow cytometry). View Reference
  3. Engleman EG, Warnke R, Fox RI, Dilley J, Benike CJ, Levy R. Studies of a human T lymphocyte antigen recognized by a monoclonal antibody.. Proc Natl Acad Sci USA. 1981; 78(3):1791-5. (Immunogen: Flow cytometry, Fluorescence activated cell sorting, Immunohistochemistry). View Reference
  4. Herodin F, Thullier P, Garin D, Drouet M. Nonhuman primates are relevant models for research in hematology, immunology and virology. Eur Cytokine Netw. 2005; 16(2):104-116. (Clone-specific: Flow cytometry). View Reference
  5. Kitani A, Chua K, Nakamura K, Strober W. Activated self-MHC-reactive T cells have the cytokine phenotype of Th3/T regulatory cell 1 T cells. J Immunol. 2000; 165(2):691-702. (Clone-specific: ELISA, Flow cytometry, Immunoprecipitation, Radioimmunoassay). View Reference
  6. Moran TP, Collier M, McKinnon KP, Davis NL, Johnston RE, Serody JS. A novel viral system for generating antigen-specific T cells. J Immunol. 2008; 175(5):3431-3438. (Clone-specific: Flow cytometry). View Reference
  7. Ren Z, Wang J, Zhu W, et al. Spontaneous transformation of adult mesenchymal stem cells from cynomolgus macaques in vitro.. Exp Cell Res. 2011; 317(20):2950-7. (Clone-specific: Flow cytometry). View Reference
  8. Sorg RV, Kogler G, Wernet P. Identification of cord blood dendritic cells as an immature CD11c- population. Blood. 1999; 93(7):2302-2307. (Clone-specific: Flow cytometry). View Reference
  9. Tomkinson BE, Wagner DK, Nelson DL, Sullivan JL. Activated lymphocytes during acute Epstein-Barr virus infection.. J Immunol. 1987; 139(11):3802-7. (Clone-specific: Flow cytometry). View Reference
View All (9) View Less
940010 Rev. 4

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.