Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD59

BD™ AbSeq Oligo Mouse Anti-Human CD59

Clone p282 (H19)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
HRF-20; MAC-inhibitory protein; MAC-IP; MACIF; MEM43; MIRL; Protectin; 1F5
966
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAAGCGATGGTATGCGATGGTTAAAGTGGGCCTAGC
AHS0224
Human Erythrocytes
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940301 Rev. 2
Antibody Details
Down Arrow Up Arrow
p282 (H19)

The p282 (HI9) monoclonal antibody specifically binds to CD59, a 19 kDa glycosylphosphatidylinositol (GPI)-anchored glycoprotein, expressed on hematopoietic and non-hematopoietic cells. Because of its interaction with complement activated products, CD59 has been termed membrane-attack-complex-inhibitory factor (MACIF), homologus restriction factor (HRF20), membrane inhibitor of reactive lysis (MIRL) and Protectin. It inhibits the cytolytic activity of the complement system by binding to C8 and C9, thereby blocking the assembly of the membrane attack complex. CD59 also participates in spontaneous T-cell/erythrocyte adhesion, interacts with CD2, and plays a role in T-cell activation.

940301 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940301 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940301" on CiteAb

Development References (8)

  1. Davies A, Lachmann PJ. Membrane defence against complement lysis: the structure and biological properties of CD59. Immunol Res. 1993; 12(3):258-275. (Biology). View Reference
  2. Deckert M, Kubar J, Bernard A. CD58 and CD59 molecules exhibit potentializing effects in T cell adhesion and activation. J Immunol. 1992; 148(3):672-677. (Clone-specific: Blocking, Flow cytometry, Functional assay, Immunoaffinity chromatography, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  3. Deckert M, Kubar J, Zoccola D, et al. CD59 molecule: a second ligand for CD2 in T cell adhesion. Eur J Immunol. 1992; 22(11):2943-2947. (Clone-specific: Blocking). View Reference
  4. Groux H, Huet S, Aubrit F, Tran HC, Boumsell L, Bernard A. A 19-kDa human erythrocyte molecule H19 is involved in rosettes, present on nucleated cells, and required for T cell activation. Comparison of the roles of H19 and LFA-3 molecules in T cell activation. J Immunol. 1989; 142(9):3013-3020. (Immunogen: Blocking, Flow cytometry, Functional assay, Immunoaffinity chromatography, Immunoprecipitation, Inhibition). View Reference
  5. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  6. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  7. Whitlow MB, Iida K, Stefanova I, Bernard A, Nussenzweig V. H19, a surface membrane molecule involved in T-cell activation, inhibits channel formation by human complement. Cell Immunol. 1990; 126(1):176-184. (Biology). View Reference
  8. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (8) View Less
940301 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.