Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD49d

BD™ AbSeq Oligo Mouse Anti-Human CD49d

Clone 9F10

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Integrin α4 chain; Integrin alpha 4; ITGA4; IA4; alpha 4 subunit of VLA-4
3676
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TAGGGTGACTTAGCGATTGATGCGTATGTTTGGGCG
AHS0063
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940059 Rev. 3
Antibody Details
Down Arrow Up Arrow
9F10

The 9F10 monoclonal antibody specifically reacts with the integrin α4 chain, that is expressed as a heterodimer with either of two β integrin subunits, β1 (CD29) or β7. The α4β1 integrin (VLA-4) is expressed on lymphocytes, monocytes, thymocytes, NK cells, and several B- and T-cell lines, and mediates binding to VCAM-1 (CD106) and the CS-1 region of fibronectin. The α4β7 integrin has a similar tissue distribution, except it is found on only a small subpopulation of thymocytes. Integrin α4β7 also binds fibronectin and VCAM-1, and has been shown in the mouse to preferentially bind the mucosal vascular addressin molecule, MAdCAM-1. This antibody is useful for studies of the expression by and function of cells that express α4 chain-containing integrins.  This clone cross-reacts with a subset of peripheral blood lymphocytes, monocytes, and some granulocytes of baboon and both rhesus and cynomolgus macaque monkeys. The distribution on leukocytes is similar to that observed with human peripheral blood leukocytes.

940059 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940059 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940059" on CiteAb

Development References (5)

  1. Berlin C, Berg EL, Briskin MJ, et al. Alpha 4 beta 7 integrin mediates lymphocyte binding to the mucosal vascular addressin MAdCAM-1. Cell. 1993; 74(1):185-195. (Biology). View Reference
  2. Hemler ME, Huang C, Takada Y, Schwarz L, Strominger JL, Clabby ML. Characterization of the cell surface heterodimer VLA-4 and related peptides. J Biol Chem. 1987; 262(24):11478-11485. (Biology). View Reference
  3. Hemler ME, Kassner P, Bodorova J. CD49d cluster report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:1617-1618.
  4. Hemler ME. VLA proteins in the integrin family: structures, functions, and their role on leukocytes. Annu Rev Immunol. 1990; 8:365-400. (Biology). View Reference
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
940059 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.