Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD80 (B7-1)

BD™ AbSeq Oligo Mouse Anti-Human CD80 (B7-1)

Clone L307.4 (also known as L307) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
B7.1; B7-1; Activation B7-1 antigen; B7; BB1; CD28LG; CD28LG1; LAB7; L307
941
2 µl
Mouse C3H, also known as C3H/He, C3H/Bi IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT
AHS0046
Human B7-transfected L cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940036 Rev. 3
Antibody Details
Down Arrow Up Arrow
L307.4

The L307 monoclonal antibody specifically binds to B7/BB1, a 60 kDa transmembrane glycoprotein that was clustered as CD80 in the Fifth International Workshop on Human Leukocyte Differentiation Antigens. CD80, a member of the Ig supergene family, is expressed on activated B cells, T cells, macrophages, and dendritic cells. It is the ligand for two molecules expressed on T cells, CD28 and CD152 (CTLA-4). CD80 is also expressed on activated CD4-positive and CD8-positive T cells, appearing late after activation suggesting that activated T cells may be capable of autocrine costimulation via the CD28 activation pathway. The binding of CD28 by anti-CD28 or by CD80 results in T-cell activation and a signal for IL-2 production.

940036 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940036 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940036" on CiteAb

Development References (5)

  1. Azuma M, Yssel H, Phillips JH, Spits H, Lanier LL. Functional expression of B7/BB1 on activated T lymphocytes. J Exp Med. 1993; 177(3):845-850. (Immunogen: Flow cytometry, Immunoprecipitation, Induction). View Reference
  2. Engel P, Wagner N, Tedder TF. CD80 Workshop report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:682-684.
  3. Koulova L, Clark EA, Shu G, Dupont B. The CD28 ligand B7/BB1 provides costimulatory signal for alloactivation of CD4+ T cells. J Exp Med. 1991; 173(3):759-762. (Biology). View Reference
  4. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  5. Schwartz RH. Costimulation of T lymphocytes: the role of CD28, CTLA-4, and B7/BB1 in interleukin-2 production and immunotherapy. Cell. 1992; 71(7):1065-1068. (Biology). View Reference
940036 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.