Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD40

BD™ AbSeq Oligo Mouse Anti-Human CD40

Clone 5C3 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
TNFRSF5; TNF receptor superfamily member 5; CD40L receptor; Bp50; p50
958, 707749, 101002143, 102118696
2 µl
Mouse IgG1, κ
Human, Rhesus, Cynomolgus, Baboon (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG
AHS0117
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940049 Rev. 4
Antibody Details
Down Arrow Up Arrow
5C3

This 5C3 monoclonal antibody specifically binds to CD40, a 45-48 kDa type I integral membrane glycoprotein. CD40 is expressed on B lymphocytes, but is not expressed on terminally differentiated B cells. CD40 is also expressed by endothelial cells, basal epithelial cells and some epithelial cell carcinomas, follicular dendritic cells, macrophages, fibroblasts, keratinocytes, and CD34+ hematopoietic progenitor cells. This antibody is useful for studying the roles played by CD40 in B-cell growth, proliferation, and differentiation including immunoglobulin isotype switching. Anti-CD40 antibodies have been reported to stimulate B-cell proliferation when costimulated with anti-µ, anti-CD20 antibodies or with phorbol esters. 5C3 is capable of inducing B-cell proliferation when presented with IL-4.

940049 Rev. 4
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940049 Rev.4
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940049" on CiteAb

Development References (6)

  1. Clark EA, Ledbetter JA. Activation of human B cells mediated through two distinct cell surface differentiation antigens, Bp35 and Bp50. Proc Natl Acad Sci U S A. 1986; 83(12):4494-4498. (Biology). View Reference
  2. Galy AH, Spits H. CD40 is functionally expressed on human thymic epithelial cells. J Immunol. 1992; 149(3):775-782. (Biology). View Reference
  3. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  4. Lin G-X, Yang X, Hollemweguer E, et al. Cross-reactivity of CD antibodies in eight animal species. In: Mason D. David Mason .. et al., ed. Leucocyte typing VII : white cell differentiation antigens : proceedings of the Seventh International Workshop and Conference held in Harrogate, United Kingdom. Oxford: Oxford University Press; 2002:519-523.
  5. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  6. Zola H. Leukocyte and stromal cell molecules : the CD markers. Hoboken, N.J.: Wiley-Liss; 2007.
View All (6) View Less
940049 Rev. 4

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.