Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD279 (PD-1)

BD™ AbSeq Oligo Hamster Anti-Mouse CD279 (PD-1)

Clone J43

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
Ly101; PD-1; Pdc1; Pdcd1; mPD-1; programmed cell death 1 protein; programmed cell death protein 1; protein PD-1
18566
2 µl
Armenian Hamster IgG2, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CGTGAGGAGGATAGTAGCGGTTAAATTCGGACAGTC
AMM2024
Syrian Hamster kidney cell line BKH transfected with Pdcd1 cDNA
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940128 Rev. 3
Antibody Details
Down Arrow Up Arrow
J43

The J43 monoclonal antibody specifically recognizes CD279 which is also known as PD-1 (programmed death-1). CD279 is a 50-55-kDa glycoprotein encoded by the Pdcd1 gene of the CD28 family of the Ig superfamily. The expression of Pdcd1 mRNA and PD-1 protein is tightly regulated. PD-1 is transiently expressed on CD4-CD8 thymocytes, it is upregulated on some cell lines upon induction of apoptosis, it is induced on thymocytes and splenic T and B lymphocytes after stimulation through their antigen receptors, and it is induced on activated myeloid cells. In addition, Pdcd1 mRNA is transiently expressed in developing B lymphocytes at the pro-B-cell stage. The presence of an ITIM (Immunoreceptor Tyrosine-based Inhibitory Motif) on PD-1's intracytoplasmic region and the development of splenomegaly and breakdown of peripheral tolerance in PD-1[-/-] mice suggest that PD-1 is involved in the negative regulation of immune responses. The PD-1 ligands, B7-H1 (also known as PD-L1, CD274) and B7-DC (PD-L2, CD273), are members of the B7 family of the Ig superfamily. The J43 antibody blocks the binding of PD-1 to its two ligands.

940128 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940128 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940128" on CiteAb

Development References (8)

  1. Agata Y, Kawasaki A, Nishimura H, et al. Expression of the PD-1 antigen on the surface of stimulated mouse T and B lymphocytes. Int Immunol. 1996 May; 8(5):765-772. (Immunogen: Flow cytometry, Immunoprecipitation). View Reference
  2. Ansari MJ, Salama AD, Chitnis T, et al. The programmed death-1 (PD-1) pathway regulates autoimmune diabetes in nonobese diabetic (NOD) mice. J Exp Med. 2003 July; 198(1):63-69. (Clone-specific: Blocking). View Reference
  3. Carreno BM, Collins M. The B7 family of ligands and its receptors: New pathways for costimulation and inhibition of immune responses. Annu Rev Immunol. 2002; 20:29-53. (Biology). View Reference
  4. Finger LR, Pu J, Wasserman R, et al. The human PD-1 gene: complete cDNA, genomic organization, and developmentally regulated expression in B cell progenitors. Gene. 1997 September; 197(1-2):177-187. (Biology). View Reference
  5. Nishimura H, Agata Y, Kawasaki A, et al. Developmentally regulated expression of the PD-1 protein on the surface of double-negative (CD4-CD8-) thymocytes. Int Immunol. 1996 May; 8(5):773-780. (Clone-specific: Flow cytometry). View Reference
  6. Nishimura H, Minato N, Nakano T, Honjo T. Immunological studies on PD-1 deficient mice: implication of PD-1 as a negative regulator for B cell responses. Int Immunol. 1998; 10(10):1563-1572. (Clone-specific: Flow cytometry). View Reference
  7. Salama AD, Chitnis T, Imitola J, et al. Critical role of the programmed death-1 (PD-1) pathway in regulation of experimental autoimmune encephalomyelitis. J Exp Med. 2003 July; 198(1):71-78. (Clone-specific: Blocking). View Reference
  8. Tsushima F, Iwai H, Otsuki N, et al. Preferential contribution of B7-H1 to programmed death-1-mediated regulation of hapten-specific allergic inflammatory responses. Eur J Immunol. 2003; 33(10):2773-2782. (Clone-specific). View Reference
View All (8) View Less
940128 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.