Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD162

BD™ AbSeq Oligo Rat Anti-Mouse CD162

Clone 2PH1 (RUO)

940184
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Selplg; PSGL-1; Psgl1; Selp1; Selpl; P-selectin glycoprotein ligand 1
20345
2 µl
Rat LEW, also known as Lewis IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TGGTGTCCTAAATGGGTTCGAAATACGTAAGCTGCT
AMM2080
Ovalbumin-conjugated peptide covering amino acids 42 to 60 of mouse PSGL-1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940184 Rev. 2
Antibody Details
Down Arrow
2PH1

The 2PH1 monoclonal antibody specifically binds to the N-terminus of CD162 (P-selectin glycoprotein ligand-1, PSGL-1), encoded by the Selplg gene. PSGL-1 is expressed on the cell surface as a homodimer of approximately 230 kDa. In the mouse, Selpl mRNA is detected in most tissues, with high levels found in hematopoietic cells, brain, and adipose tissue. Flow cytometric analyses have revealed CD162 expression on bone marrow-derived mast and dendritic cells, splenic leukocytes, platelets, peripheral blood neutrophils, and neutrophil and T-cell lines. PSGL-1 is a ligand for P-selectin (CD62P) and is involved in leukocyte rolling, the migration of leukocytes into inflamed tissues, and responses to vascular injury. It is a sialomucin that must be specifically sialylated, fucosylated, and sulfated to bind P-selectin. There is also evidence that other ligands for PSGL-1 and CD62P may exist. The 2PH1 antibody is reported to block binding of mouse leukocytes to CD62P, but the 4RA10 antibody (Cat. No. 557787) has significantly greater blocking activity.

940184 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940184 Rev.2
Citations & References
Down Arrow

Development References (12)

  1. Borges E, Eytner R, Moll T, et al. The P-selectin glycoprotein ligand-1 is important for recruitment of neutrophils into inflamed mouse peritoneum. Blood. 1997; 90(5):1934-1942. (Immunogen: Blocking, ELISA, Flow cytometry, Immunoprecipitation, Inhibition, In vivo exacerbation). View Reference
  2. Borges E, Tietz W, Steegmaier M, et al. P-selectin glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on T helper 2 cells binds to P-selectin and supports migration into inflamed skin. J Exp Med. 1997; 185(3):573-578. (Biology). View Reference
  3. Frenette PS, Denis CV, Weiss L, et al. P-Selectin glycoprotein ligand 1 (PSGL-1) is expressed on platelets and can mediate platelet-endothelial interactions in vivo. J Exp Med. 2000; 191(8):1413-1422. (Biology). View Reference
  4. Hirata T, Furie BC, Furie B. P-, E-, and L-selectin mediate migration of activated CD8+ T lymphocytes into inflamed skin. J Immunol. 2002; 169(8):4307-4313. (Clone-specific: Flow cytometry). View Reference
  5. Hirata T, Merrill-Skoloff G, Aab M, Yang J, Furie BC, Furie B. P-Selectin glycoprotein ligand 1 (PSGL-1) is a physiological ligand for E-selectin in mediating T helper 1 lymphocyte migration. J Exp Med. 2000; 192(11):1669-1675. (Biology). View Reference
  6. Li F, Wilkins PP, Crawley S, Weinstein J, Cummings RD, McEver RP. Post-translational modifications of recombinant P-selectin glycoprotein ligand-1 required for binding to P- and E-selectin. J Biol Chem. 1996; 271(6):3255-3264. (Biology). View Reference
  7. Pendl GG, Robert C, Steinert M, et al. Immature mouse dendritic cells enter inflamed tissue, a process that requires E- and P-selectin, but not P-selectin glycoprotein ligand 1. Blood. 2002; 99(3):946-956. (Clone-specific: Blocking, Flow cytometry, Immunoprecipitation). View Reference
  8. Phillips JW, Barringhaus KG, Sanders JM, et al. Single injection of P-selectin or P-selectin glycoprotein ligand-1 monoclonal antibody blocks neointima formation after arterial injury in apolipoprotein E-deficient mice. Circulation. 2003; 107(17):2244-2249. (Biology). View Reference
  9. Sperandio M, Smith ML, Forlow SB, et al. P-selectin glycoprotein ligand-1 mediates L-selectin-dependent leukocyte rolling in venules. J Exp Med. 2003; 197(10):1355-1363. (Clone-specific: Flow cytometry). View Reference
  10. Steegmaier M, Blanks JE, Borges E, Vestweber D. P-selectin glycoprotein ligand-1 mediates rolling of mouse bone marrow-derived mast cells on P-selectin but not efficiently on E-selectin. Eur J Immunol. 1997; 27(6):1339-1345. (Biology). View Reference
  11. Xia L, Sperandio M, Yago T, et al. P-selectin glycoprotein ligand-1-deficient mice have impaired leukocyte tethering to E-selectin under flow. J Clin Invest. 2002; 109(7):939-950. (Clone-specific: Flow cytometry). View Reference
  12. Yang J, Galipeau J, Kozak CA, Furie BC, Furie B. Mouse P-selectin glycoprotein ligand-1: molecular cloning, chromosomal localization, and expression of a functional P-selectin receptor. Blood. 1996; 87(10):4176-4186. (Biology). View Reference
View All (12) View Less
940184 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.