Skip to main content Skip to navigation
Oligo Mouse Anti-Human Sox17
Product Details
Down Arrow Up Arrow


BD® AbSeq
SOX-17, SOX17, FLJ22252
64321
2 µl/test
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing Intracellular CITE-seq (Tested During Development)
TAAGGTCCGTCGATAAAGCATAGAAAGGCGTGTAGT
AHS471
Human Sox17 Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for = 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

When using BD® AbSeq intracellular markers with the Single Cell 3' Sequencing Intracellular CITE-seq, cells must first be fixed and permeabilized using the BD Rhapsody™ Intracellular AbSeq Buffer Kit before the antibody-oligo can bind to the protein. Refer to the list of required companion products below and see BD Rhapsody™ System Single-Cell Labelling with BD® AbSeq Ab-Oligos for Intracellular CITE-seq (Doc ID: 23-24464) for the complete BD® AbSeq intracellular multiomics staining protocol. Contact your local Field Application Specialist (FAS) for additional guidance.

Use standard laboratory safety protocols. Read and understand the safety data sheets (SDSs) before handling chemicals. To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bdscomix.bd.com.

Warning: All biological specimens and materials contacting them are considered biohazardous. Handle as if capable of transmitting infection and dispose of with proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves.

Product Notices

  1. Please refer to www.bdbiosciences.com/us/s/resources for technical protocols.
  2. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. Illumina is a trademark of Illumina, Inc.
  9. For U.S. patents that may apply, see bd.com/patents.
940511 Rev. 2
Antibody Details
Down Arrow Up Arrow
P7-969

The P7-969 monoclonal antibody reacts with human Sox17, a member of the SOX (SRY-releated HMG-box) family of transcription factors. SOX family members contain a DNA binding domain (HMG-box) and are involved in the control of development. Sox17 is expressed in primitive and definitive endoderm and regulates fetal and neonatal hematopoietic stem cell proliferation.

940511 Rev. 2
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940511 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940511" on CiteAb

Development References (5)

  1. D'Amour KA, Agulnick AD, Eliazer S, Kelly OG, Kroon E, Baetge EE. Efficient differentiation of human embryonic stem cells to definitive endoderm.. Nat Biotechnol. 2005; 23(12):1534-41. (Methodology: Cell differentiation). View Reference
  2. Katoh M. Molecular cloning and characterization of human SOX17. Int J Mol Med. 2002; 9(2):153-157. (Biology). View Reference
  3. Kim I, Saunders TL, Morrison SJ. Sox17 dependence distinguishes the transcriptional regulation of fetal from adult hematopoietic stem cells. Cell. 2007; 130(3):470-483. (Biology). View Reference
  4. Serrano AG, Gandillet A, Pearson S, Lacaud G, Kouskoff V. Contrasting effects of Sox17- and Sox18-sustained expression at the onset of blood specification. Blood. 2010; 115(19):3895-3898. (Biology). View Reference
  5. Séguin CA, Draper JS, Nagy A, Rossant J. Establishment of endoderm progenitors by SOX transcription factor expression in human embryonic stem cells. Cell Stem Cell. 2008; 3(2):182-185. (Biology). View Reference
940511 Rev. 2

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.