Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD86 (B7-2)

BD™ AbSeq Oligo Mouse Anti-Human CD86 (B7-2)

Clone 2331 (FUN-1)

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
B7.2; B7-2; B-lymphocyte activation antigen B7-2; B70; BU63; CD28LG2; LAB72
942
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GCGAACGGTTAGTAATAGCGAGATAGTGCGAATAGC
AHS0057
Human HBL-1 Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940025 Rev. 3
Antibody Details
Down Arrow Up Arrow
2331 (FUN-1)

The 2331 (FUN-1) monoclonal antibody specifically recognizes a 75 kDa transmembrane cell surface protein, CD86 (B70/B7-2), expressed primarily on monocytes, dendritic cells and activated B cells. Competitive binding assays demonstrate that, while both 2331 (FUN-1) and IT2.2 (Anti-CD86) antibodies specifically recognize the same molecule, they react with different epitopes. CD86 is a ligand for CD28 and CTLA-4 and plays an important role in costimulation of T cells in primary immune response. The 2331 (FUN-1) antibody blocks the costimulatory activity of CD86 when tested in functional studies.

940025 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940025 Rev.3
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Engel P, Gribben JG, Freeman GJ, et al. The B7-2 (B70) costimulatory molecule expressed by monocytes and activated B lymphocytes is the CD86 differentiation antigen. Blood. 1994; 84(5):1402-1407. (Clone-specific: Blocking, Enhancement, Flow cytometry, Functional assay, Inhibition). View Reference
  2. Engel P, Wagner N, Tedder TF. CD86 Workshop Report. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:703-705.
  3. Nozawa Y, Abe M, Wakasa H. Three mAb, FUN-1, FB1, and FB21, that recognize B-cell antigens in frozen or paraffin-embedded tissue sections. In: Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995:705-706.
  4. Nozawa Y, Wachi E, Tominaga K, Abe M, Wakasa H. A novel monoclonal antibody (FUN-1) identifies an activation antigen in cells of the B-cell lineage and Reed-Sternberg cells. J Pathol. 1993; 169(3):309-315. (Immunogen: Flow cytometry, Fluorescence microscopy, Immunofluorescence, Immunohistochemistry, Immunoprecipitation). View Reference
  5. Nozawa Y, Wakasa H, Abe M. Production and usefulness of monoclonal antibodies against B cells. Fukushima J Med Sci. 1999; 45(1):1-11. (Clone-specific). View Reference
940025 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.