Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD196 (CCR6)

BD™ AbSeq Oligo Mouse Anti-Human CD196 (CCR6)

Clone 11A9

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
BN-1; C-C CKR-6; C-C chemokine receptor type 6; CC-CKR-6; CCR-6
1235
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
ACGTGTTATGGTGTTGTTCGAATTGTGGTAGTCAGT
AHS0034
Human CD196/CCR6 Peptide
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940033 Rev. 3
Antibody Details
Down Arrow Up Arrow
11A9

The 11A9 monoclonal antibody specifically binds to CD196, which is also known as CCR6. CCR6 is a seven-transmembrane, G-protein-coupled, glycoprotein receptor that is a member of the beta chemokine receptor family. The human CCR6 gene has been mapped to chromosome 6q27. CCR6 is a receptor for the CC chemokine CCL20/MIP-3alpha/LARC/Exodus and also binds with lower affinity to and mediates responses to beta-defensin2/hBD-2. CCR6 is predominantly expressed by B lymphocytes, certain subsets of effector and memory T cells and by immature dendritic cells but not by monocytes, NK cells, or granulocytes. Skin-homing CLA (Cutaneous Lymphocyte Antigen)-positive memory T cells, Th1 cells, regulatory T cells and IL-17A-producing Th17 cells predominantly express high levels of CCR6. CCR6 mediates the trafficking of T, B, and dendritic cells to epithelial sites near the skin and mucosal surfaces during inflammatory and immunological responses. An N-terminal peptide of human CCR6 was used as an immunogen to generate the 11A9 hybridoma. The 11A9 antibody does not cross-react with human CCR1, CCR2, CCR3, CCR4, CCR5, CCR7, CCR8, CCR9, CXCR1, CXCR2, CXCR3, CXCR4 and CXCR5 receptors. This antibody is NOT a neutralizing antibody.

940033 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940033 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940033" on CiteAb

Development References (15)

  1. Baba M, Imai T, Nishimura M, et al. Identification of CCR6, the specific receptor for a novel lymphocyte-directed CC chemokine LARC. J Biol Chem. 1997; 272(23):14893-14898. (Biology). View Reference
  2. Brandes M, Willimann K, Lang AB, et al. Flexible migration program regulates gamma delta T-cell involvement in humoral immunity. Blood. 2003; 102(10):3693-3701. (Clone-specific: Flow cytometry). View Reference
  3. Cabezon R, Sintes J, Llinas L, Benitez-Ribas D. Analysis of HLDA9 mAbs on plasmacytoid dendritic cell. Immunol Lett. 2011; 134(2):167-173. (Clone-specific: Flow cytometry). View Reference
  4. Greaves DR, Wang W, Dairaghi DJ, et al. CCR6, a CC chemokine receptor that interacts with macrophage inflammatory protein 3alpha and is highly expressed in human dendritic cells. J Exp Med. 1997; 186(6):837-844. (Biology). View Reference
  5. Homey B, Dieu-Nosjean MC, Wiesenborn A, et al. Up-regulation of macrophage inflammatory protein-3 alpha/CCL20 and CC chemokine receptor 6 in psoriasis. J Immunol. 2000; 164(12):6621-6632. (Biology). View Reference
  6. Kim CH, Rott L, Kunkel EJ, et al. Rules of chemokine receptor association with T cell polarization in vivo. J Clin Invest. 2001; 108(9):1331-1339. (Biology). View Reference
  7. Liao F, Alderson R, Su J, Ullrich SJ, Kreider BL, Farber JM. STRL22 is a receptor for the CC chemokine MIP-3alpha. Biochem Biophys Res Commun. 1997; 236(1):212-217. (Biology). View Reference
  8. Liao F, Rabin RL, Smith CS, Sharma G, Nutman TB, Farber JM. CC-chemokine receptor 6 is expressed on diverse memory subsets of T cells and determines responsiveness to macrophage inflammatory protein 3 alpha. J Immunol. 1999; 162(1):186-194. (Biology). View Reference
  9. Liao F, Shirakawa AK, Foley JF, Rabin RL, Farber JM. Human B cells become highly responsive to macrophage-inflammatory protein-3 alpha/CC chemokine ligand-20 after cellular activation without changes in CCR6 expression or ligand binding. J Immunol. 2002; 168(10):4871-4880. (Clone-specific: Flow cytometry). View Reference
  10. Lim HW, Lee J, Hillsamer P, Kim CH. Human Th17 cells share major trafficking receptors with both polarized effector T cells and FOXP3+ regulatory T cells. J Immunol. 2008; 180(1):122-129. (Biology). View Reference
  11. Llinas L, Lazaro A, de Salort J, Matesanz-Isabel J, Sintes J, Engel P. Expression profiles of novel cell surface molecules on B-cell subsets and plasma cells as analyzed by flow cytometry. Immunol Lett. 2011; 134(2):113-121. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  12. Ramos-Medina R, Montes-Moreno S, Maestre L, et al. Immunohistochemical analysis of HLDA9 Workshop antibodies against cell-surface molecules in reactive and neoplastic lymphoid tissues. Immunol Lett. 2011; 134(2):150-156. (Clone-specific: Immunohistochemistry). View Reference
  13. Sallusto F, Lenig D, Forster R, Lipp M, Lanzavecchia A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature. 1999; 401(6754):708-712. (Clone-specific: Flow cytometry). View Reference
  14. Thomas SY, Banerji A, Medoff BD, Lilly CM, Luster AD. Multiple chemokine receptors, including CCR6 and CXCR3, regulate antigen-induced T cell homing to the human asthmatic airway. J Immunol. 2007; 179(3):1901-1912. (Clone-specific: Flow cytometry). View Reference
  15. Yang D, Chertov O, Bykovskaia SN, et al. Beta-defensins: linking innate and adaptive immunity through dendritic and T cell CCR6. Science. 1999; 286(5439):525-528. (Biology). View Reference
View All (15) View Less
940033 Rev. 3

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.