Skip to main content Skip to navigation
Oligo Rat Anti-Mouse IL-23 Receptor

BD™ AbSeq Oligo Rat Anti-Mouse IL-23 Receptor

Clone O78-1208 (RUO)

562151
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Il23r; IL-23R; Interleukin 23 receptor
209590
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CACTGGCGGTTGGATTGTAGAGGGTCGTATATTGCT
AMM2131
Mouse IL-23 Receptor Recombinant Protein
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940400 Rev. 2
Antibody Details
Down Arrow
O78-1208

The O78-1208 monoclonal antibody specifically binds to the mouse Interleukin-23 Receptor (IL-23R) subunit that is encoded by the il23r gene. The IL-23R subunit is a type I transmembrane glycoprotein and member of the hemopoietin receptor superfamily. The mouse IL-23 Receptor complex is comprised of IL-23R and IL-12 receptor beta 1 (IL-12Rβ1) subunits. The IL-23R complex can bind IL-23, a cytokine that plays roles in innate and adaptive immunity as well as in autoimmune diseases, eg, by the generation and maintenance of Th17 cells. Mouse IL-23R is expressed by activated/memory CD4+ T cells, Th1, Th2 and Th17 cells, γδ T cells, dendritic cells and macrophages as determined by IL-23R mRNA expression and IL-23R-GFP reporter mouse studies. The IL-23-bound IL-23R  complex transduces an intracellular signal pathway mediated by a Jak-STAT signaling cascade.

940400 Rev. 2
Citations & References
Down Arrow

Development References (6)

  1. Awasthi A, Riol-Blanco L, Jager A, et al. Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells. J Immunol. 2009; 182(10):5904-5908. (Biology). View Reference
  2. Jones LL, Alli R, Li B, Geiger TL. Differential T Cell Cytokine Receptivity and Not Signal Quality Distinguishes IL-6 and IL-10 Signaling during Th17 Differentiation.. J Immunol. 2016; 196(7):2973-85. (Clone-specific: Flow cytometry). View Reference
  3. Lankford CS, Frucht DM. A unique role for IL-23 in promoting cellular immunity. J Leukoc Biol. 2003; 73(1):49-56. (Biology). View Reference
  4. Monk JM, Hou TY, Turk HF, McMurray DN, Chapkin RS. n3 PUFAs reduce mouse CD4+ T-cell ex vivo polarization into Th17 cells.. J Nutr. 2013; 143(9):1501-8. (Clone-specific: Flow cytometry). View Reference
  5. Parham C, Chirica M, Timans J, et al. A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R. J Immunol. 2002; 168(11):5699-5708. (Biology: Calcium Flux). View Reference
  6. Petermann F, Rothhammer V, Claussen MC, et al. gammadelta T cells enhance autoimmunity by restraining regulatory T cell responses via an interleukin-23-dependent mechanism. Immunity. 2010; 33(3):351-363. (Biology). View Reference
View All (6) View Less
940400 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.