Skip to main content Skip to navigation
Oligo Rat Anti-Mouse CD23

BD™ AbSeq Oligo Rat Anti-Mouse CD23

Clone B3B4 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
FcεRII; Fc-epsilon-RII; Fcer2a; Ly-42; Low-affinity IgE receptor; Fcer2
14128
2 µl
Rat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTTCCGTGTAATATAGCGTAGGTAGTGTGGGTCATC
AMM2057
FcεR isolated from the mouse B hybridoma line O1.2B2
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940161 Rev. 2
Antibody Details
Down Arrow Up Arrow
B3B4

The B3B4 monoclonal antibody specifically binds to CD23, the low affinity IgE Fc receptor (FcεRII) expressed on mature resting conventional B lymphocytes, but not on B-1 cells (CD5+ B cells) or T lymphocytes. It does not react with high-affinity IgE receptors, as demonstrated on mouse mast cell lines. The regulation of CD23 surface expression on activated B cells appears to be complex, depending upon the mode of activation and the presence of cytokines. IgE synthesis is negatively regulated by CD23, and CD23 expression is upregulated on splenocytes in the presence of IgE. CD23 is also upregulated on follicular dendritic cells in the lymph nodes of immunized mice, and a subset of splenic dendritic cells expresses CD23. The B3B4 antibody abrogates antigen-specific IgE-dependent modulation of immune responses in normal mice. This monoclonal antibody also blocks IgE binding and eosinophil infiltration in the lung of immunized mice. Different in vivo results have been obtained when using the intact B3B4 antibody or the F(ab')2 fragments. B3B4 mAb does not cross-react with rat or human IgE Fc Receptor.

940161 Rev. 2
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940161 Rev.2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940161" on CiteAb

Development References (14)

  1. Conrad DH, Waldschmidt TJ, Lee WT, et al. Effect of B cell stimulatory factor-1 (interleukin 4) on Fc epsilon and Fc gamma receptor expression on murine B lymphocytes and B cell lines. J Immunol. 1987; 139(7):2290-2296. (Clone-specific: Flow cytometry, Functional assay, Immunoaffinity chromatography, Immunoprecipitation, Radioimmunoassay). View Reference
  2. Coyle AJ, Wagner K, Bertrand C, Tsuyuki S, Bews J, Heusser C. Central role of immunoglobulin (Ig) E in the induction of lung eosinophil infiltration and T helper 2 cell cytokine production: inhibition by a non-anaphylactogenic anti-IgE antibody. J Exp Med. 1996; 183(4):1303-1310. (Clone-specific: Blocking). View Reference
  3. Dasic G, Juillard P, Graber P, et al. Critical role of CD23 in allergen-induced bronchoconstriction in a murine model of allergic asthma. Eur J Immunol. 1999; 29(9):2957-2967. (Clone-specific: Blocking, In vivo exacerbation). View Reference
  4. Kisselgof AB, Oettgen HC. The expression of murine B cell CD23, in vivo, is regulated by its ligand, IgE. Int Immunol. 1998; 10(9):1377-1384. (Clone-specific: Flow cytometry). View Reference
  5. Maeda K, Burton GF, Padgett DA, et al. Murine follicular dendritic cells and low affinity Fc receptors for IgE (Fc epsilon RII). J Immunol. 1992; 148(8):2340-2347. (Clone-specific: Electron microscopy, Immunohistochemistry). View Reference
  6. Oshiba A, Hamelmann E, Haczku A, et al. Modulation of antigen-induced B and T cell responses by antigen-specific IgE antibodies. J Immunol. 1997; 159(8):4056-4063. (Clone-specific: Flow cytometry). View Reference
  7. Pulendran B, Lingappa J, Kennedy MK, et al. Developmental pathways of dendritic cells in vivo: distinct function, phenotype, and localization of dendritic cell subsets in FLT3 ligand-treated mice. J Immunol. 1997; 159(5):2222-2231. (Clone-specific: Flow cytometry). View Reference
  8. Rabin E, Cong YZ, Wortis HH. Loss of CD23 is a consequence of B-cell activation. Implications for the analysis of B-cell lineages. Ann N Y Acad Sci. 1992; 651:130-142. (Biology: Flow cytometry). View Reference
  9. Rao M, Lee WT, Conrad DH. Characterization of a monoclonal antibody directed against the murine B lymphocyte receptor for IgE. J Immunol. 1987; 138(6):1845-1851. (Immunogen: Blocking, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  10. Stief A, Texido G, Sansig G, et al. Mice deficient in CD23 reveal its modulatory role in IgE production but no role in T and B cell development. J Immunol. 1994; 152(7):3378-3390. (Clone-specific: Flow cytometry, Immunohistochemistry). View Reference
  11. Waldschmidt T, Snapp K, Foy T, Tygrett L, Carpenter C. B-cell subsets defined by the Fc epsilon R. Ann N Y Acad Sci. 1992; 651:84-98. (Biology). View Reference
  12. Waldschmidt TJ, Conrad DH, Lynch RG. Expression of B cell surface receptors. II. IL-4 can accelerate the developmental expression of the murine B cell IgE Fc receptor. J Immunol. 1989; 143(9):2820-2827. (Clone-specific: Flow cytometry, Immunoaffinity chromatography). View Reference
  13. Waldschmidt TJ, Conrad DH, Lynch RG. The expression of B cell surface receptors. I. The ontogeny and distribution of the murine B cell IgE Fc receptor. J Immunol. 1988; 140(7):2148-2154. (Clone-specific: Flow cytometry). View Reference
  14. Yu P, Kosco-Vilbois M, Richards M, Kohler G, Lamers MC. Negative feedback regulation of IgE synthesis by murine CD23. Nature. 1994; 369(6483):753-756. (Biology). View Reference
View All (14) View Less
940161 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.