Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD122

BD™ AbSeq Oligo Mouse Anti-Human CD122

Clone Mik-β3 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL2RB; IL-2Rβ; IL-2R subunit beta; IL-2RB; IL15RB; IL-2/15Rb; IL-2R p75
3560
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAAAGAGATTCGTGGGTATTGGCGCAGTCATTCCT
AHS0146
Human YTS Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.
940232 Rev. 2
Antibody Details
Down Arrow Up Arrow
Mik-β3

The Mik-β3 monoclonal antibody specifically binds to CD122. CD122 is also known as IL-2/15Rβ because it is the shared p75 subunit (IL-12Rβ/IL-15Rβ) of heteromeric receptors for IL-2 and IL-15. CD122 is a 70-75 kD type I transmembrane glycoprotein expressed on  thymocytes, T cells, B cells, NK cells, monocytes, hematopoietic progenitor cells, fetal liver cells and stromal cells. The CD122 plays roles in the activation, differentiation and proliferation of various cell types including T cells, B cells and NK cells.

940232 Rev. 2
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940232" on CiteAb

Development References (4)

  1. Ishikawa T, Uchiyama T, Kamio M, Onishi R, Kodaka T, Okuma M. IL-4 down-regulates IL-2 receptor p75 by accelerating its endocytosis. Int Immunol. 1991; 3(6):517-525. (Biology). View Reference
  2. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  3. Tsudo M, Kitamura F, Miyasaka M. Characterization of the interleukin 2 receptor beta chain using three distinct monoclonal antibodies. Proc Natl Acad Sci U S A. 1989; 86(6):1982-1986. (Immunogen: Immunoprecipitation). View Reference
  4. Voss SD, Robb RJ, Weil-Hillman G, et al. Increased expression of the interleukin 2 (IL-2) receptor beta chain (p70) on CD56+ natural killer cells after in vivo IL-2 therapy: p70 expression does not alone predict the level of intermediate affinity IL-2 binding. J Exp Med. 1990; 172(4):1101-1114. (Clone-specific: Flow cytometry). View Reference
940232 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.