Skip to main content Skip to navigation
Oligo Rat Anti-Mouse Ly-6A/E

BD™ AbSeq Oligo Rat Anti-Mouse Ly-6A/E

Clone D7 (RUO)

64523207
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
Ly-6A/E; Lymphocyte antigen 6A-2/6E-1; Ly-6A.2/Ly-6E.1; Sca-1; TAP
110454
2 µl
Rat LEW, also known as Lewis IgG2a, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGGATAGGAGTGTTAGATACGGACGAATTGATGTT
AMM2026
IL-2-dependent mouse T-cell line CTL-L
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940130 Rev. 2
Antibody Details
Down Arrow
D7

The D7 monoclonal antibody recognizes Ly-6A.2 and Ly-6E.1, which are allelic members of the Ly-6 multigene family. Sca-1 (Ly6A/E), a phosphatidylinositol-anchored protein of about 18 kDa, is expressed on the multipotent hematopoietic stem cells (HSC) in the bone marrow of mice with both Ly-6 haplotypes. In mice expressing the Ly-6.2 haplotype (e.g., AKR, C57BL, C57BR, C57L, C58, DBA/2, PL, SJL, SWR, 129), Ly-6A/E is also expressed on distinct subpopulations of bone marrow and peripheral B lymphocytes as well as thymic and peripheral T lymphocytes. Strains with the Ly-6.1 haplotype (e.g., A, BALB/c, CBA, C3H/He, DBA/1, NZB) have few Ly-6A/E+ resting peripheral lymphocytes; activation of lymphocytes from mice of both Ly-6 haplotypes leads to strong expression of the Sca-1 antigen. Studies with the D7 antibody have demonstrated that Ly-6A/E may be involved in the regulation of B and T lymphocyte responses, and appears to be required for T-cell receptor-mediated T-cell activation. The purified E13-161.7 mAb (anti-Ly-6A/E) can block binding of FITC-conjugated D7 antibody to mouse splenocytes, but purified mAb D7 is unable to block binding of FITC-conjugated E13-161.7 antibody. Anti-Ly-6A/E (Sca-1) mAb may be used in combination with a Mouse Lineage Panel of antibodies to identify HSC.

940130 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940130 Rev.2
Citations & References
Down Arrow

Development References (10)

  1. Codias EK, Cray C, Baler RD, Levy RB, Malek TR. Expression of Ly-6A/E alloantigens in thymocyte and T-lymphocyte subsets: variability related to the Ly-6a and Ly-6b haplotypes. Immunogenetics. 1989; 29(2):98-107. (Clone-specific: Immunohistochemistry). View Reference
  2. Codias EK, Malek TR. Regulation of B lymphocyte responses to IL-4 and IFN-gamma by activation through Ly-6A/E molecules. J Immunol. 1990; 144(6):2197-2204. (Clone-specific: Activation). View Reference
  3. Flood PM, Dougherty JP, Ron Y. Inhibition of Ly-6A antigen expression prevents T cell activation. J Exp Med. 1990; 172(1):115-120. (Biology). View Reference
  4. Malek TR, Danis KM, Codias EK. Tumor necrosis factor synergistically acts with IFN-gamma to regulate Ly-6A/E expression in T lymphocytes, thymocytes and bone marrow cells. J Immunol. 1989; 142(6):1929-1936. (Clone-specific: Activation). View Reference
  5. Malek TR, Ortega G, Chan C, Kroczek RA, Shevach EM. Role of Ly-6 in lymphocyte activation. II. Induction of T cell activation by monoclonal anti-Ly-6 antibodies. J Exp Med. 1986; 164(3):709-722. (Clone-specific: Activation). View Reference
  6. Moore T, Bennett M, Kumar V. Transplantable NK cell progenitors in murine bone marrow. J Immunol. 1995; 154(4):1653-1663. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
  7. Ortega G, Korty PE, Shevach EM, Malek TR. Role of Ly-6 in lymphocyte activation. I. Characterization of a monoclonal antibody to a nonpolymorphic Ly-6 specificity. J Immunol. 1986; 137(10):3240-3246. (Immunogen: Flow cytometry, Immunoprecipitation, Western blot). View Reference
  8. Palfree RG, Dumont FJ, Hammerling U. Ly-6A.2 and Ly-6E.1 molecules are antithetical and identical to MALA-1. Immunogenetics. 1986; 23(3):197-207. (Clone-specific: Flow cytometry, Western blot). View Reference
  9. Rock KL, Reiser H, Bamezai A, McGrew J, Benacerraf B. The LY-6 locus: a multigene family encoding phosphatidylinositol-anchored membrane proteins concerned with T-cell activation. Immunol Rev. 1989; 111:195-224. (Biology). View Reference
  10. Yonemura Y, Ku H, Lyman SD, Ogawa M. In vitro expansion of hematopoietic progenitors and maintenance of stem cells: comparison between FLT3/FLK-2 ligand and KIT ligand. Blood. 1997; 89(6):1915-1921. (Clone-specific: Flow cytometry, Fluorescence activated cell sorting). View Reference
View All (10) View Less
940130 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.