Skip to main content Skip to navigation
Oligo Rat Anti-Human CD294 (CRTH2)

BD™ AbSeq Oligo Rat Anti-Human CD294 (CRTH2)

Clone BM16 (RUO)

940098
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CRTH2; PTGDR2 ; Prostaglandin D2 receptor 2; DL1R; DP2; GPR44
2 µl
Rat WI, also known as Wistar (outbred) IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTAGAGTTCGTGAGAGGGTAGATCGCGTTTGTAGCC
AHS0106
Human CRTH2 Transfected Cell Line
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Rat


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940098 Rev. 3
Antibody Details
Down Arrow
BM16

The BM16 monoclonal antibody specifically binds to CD294. CD294 is encoded by PTGDR2 (Prostaglandin D2 receptor 2) and is also known as CRTH2 (chemoattractant receptor-homologous molecule expressed on Th2 cells), GPR44 (G protein-coupled receptor 44), DL1R, and DP2. CD294 is a member of the G protein-coupled leukocyte chemoattractant receptor family. CD294 is expressed on Th2 cells and type-2 innate lymphoid cells (ILC2), but not Th1 type cells. CD294 is detectable on CD4+ T cells in fresh PBMC but not on B cells and NK cells. CD294 is also expressed on peripheral blood basophils and eosinophils, suggesting its involvement allergic reactions. Phenotypic analysis of CD4+ T cells expressing CRTH2 demonstrated that they were also CD45RA-negative and CD45RO+ and CD25+. These cells produce Th2- but little or no Th1-type cytokines upon stimulation with PMA and Ionomycin.

940098 Rev. 3
Citations & References
Down Arrow

Development References (3)

  1. Cosmi L, Annunziato F, Galli MIG , Maggi RME , Nagata K, Romagnani S. CRTH2 is the most reliable marker for the detection of circulating human type 2 Th and type 2 T cytotoxic cells in health and disease. Eur J Immunol. 2000; 30(10):2972-2979. (Clone-specific: Flow cytometry). View Reference
  2. Nagata K, Hirai H, Tanaka K, et al. CRTH2, an orphan receptor of T-helper-2-cells, is expressed on basophils and eosinophils and responds to mast cell-derived factor(s). FEBS Lett. 1999; 459(2):195-199. (Clone-specific: Flow cytometry). View Reference
  3. Nagata K, Tanaka K, Ogawa K, et al. Selective expression of a novel surface molecule by human Th2 cells in vivo. J Immunol. 1999; 162(3):1278-1286. (Immunogen: Blocking, Cell separation, Flow cytometry, Western blot). View Reference
940098 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.