Skip to main content Skip to navigation
Oligo Mouse Anti-Human IgG

BD™ AbSeq Oligo Mouse Anti-Human IgG

Clone G18-145

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
IGHG1, IGHG2, IGHG3 and IGHG4
3500, 3501, 3502, 3503
2 µl
Mouse IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGGTAGGTTATCGTAGGGTAGACTTAGCGGGCATTG
AHS0059
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940027 Rev. 4
Antibody Details
Down Arrow Up Arrow
G18-145

IgG is an important component of the humoral immune response, helping to control infection.  IgG is produced by plasma B-cells and may be found in extracellular fluids, such as blood, lymph, peritoneal, and cerebrospinal fluids.  IgG monomers consist of two light and two heavy chains containing two antigen binding sites.  There are four IgG subclasses found in human, mouse and rat species, which include IgG1, IgG2, IgG3 and IgG4.  The G18-145 monoclonal antibody specifically binds to the heavy chain of human immunoglobulin G subclasses: IgG1, IgG2, IgG3 and IgG4.  The G18-145 antibody has been reported not to react with the heavy chains of other human immunoglobulin isotypes.

940027 Rev. 4
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940027 Rev.4
Citations & References
Down Arrow Up Arrow

Development References (4)

  1. Jourdan M, Caraux A, Caron G, et al. Characterization of a transitional preplasmablast population in the process of human B cell to plasma cell differentiation. J Immunol. 2011; 187(8):3931-3941. (Clone-specific: Flow cytometry). View Reference
  2. Odendahl M, Mei H, Hoyer BF, et al. Generation of migratory antigen-specific plasma blasts and mobilization of resident plasma cells in a secondary immune response. Blood. 2005; 105(4):1614-1621. (Clone-specific: Flow cytometry). View Reference
  3. Roll P, Palanichamy A, Kneitz C, Dorner T, Tony HP. Regeneration of B cell subsets after transient B cell depletion using anti-CD20 antibodies in rheumatoid arthritis. Arthritis Rheum. 2006; 54(8):2377-2386. (Clone-specific: Flow cytometry). View Reference
  4. Scheeren FA, Naspetti M, Diehl S, et al. STAT5 regulates the self-renewal capacity and differentiation of human memory B cells and controls Bcl-6 expression. Nat Immunol. 2005; 6(3):303-313. (Clone-specific: Flow cytometry). View Reference
940027 Rev. 4

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.