Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD62P

BD™ AbSeq Oligo Mouse Anti-Human CD62P

Clone AC1.2 (RUO)

940309
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
SELP; PSEL; P-selectin; PADGEM; LECAM3; GMP-140; GRMP; GMP140
6403
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
TTGTGGTTGTATGCGATCGATTGACTAGGGAGCTGT
AHS0234
Activated Human Platelets
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940309 Rev. 2
Antibody Details
Down Arrow
AC1.2

The AC1.2 monoclonal antibody specifically binds to CD62P. CD62P is a 140 kDa type I transmembrane glycoprotein that is also known as P-Selectin, Platelet activation-dependent granule membrane protein (PADGEM), or GMP-140. P-Selectin is stored in the α-granules of platelets and the Weibel-Palade bodies of endothelial cells, and is rapidly transported to the plasma membrane upon activation. P-Selectin may mediate the initial adhesive interactions of neutrophils and monocytes with endothelium in inflammatory responses, and of activated platelets to neutrophils and monocytes in hemostasis.

940309 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940309 Rev.2
Citations & References
Down Arrow

Development References (8)

  1. Carmody MW, Ault KA, Mitchell JG, Rote NS, Ng AK. Production of monoclonal antibodies specific for platelet activation antigens and their use in evaluating platelet function.. Hybridoma. 1990; 9(6):631-41. (Clone-specific: Flow cytometry). View Reference
  2. Crovello CS, Furie BC, Furie B. Rapid phosphorylation and selective dephosphorylation of P-selectin accompanies platelet activation.. J Biol Chem. 1993; 268(20):14590-3. (Clone-specific: Immunoprecipitation, Radioimmunoassay). View Reference
  3. Etingin OR, Silverstein RL, Hajjar DP. Identification of a monocyte receptor on herpesvirus-infected endothelial cells.. Proc Natl Acad Sci USA. 1991; 88(16):7200-3. (Clone-specific: Flow cytometry). View Reference
  4. Kansas GS. Selectins and their ligands: current concepts and controversies. Blood. 1997; 88(9):3259-3287. (Biology). View Reference
  5. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  6. Larsen E, Celi A, Gilbert GE, et al. PADGEM protein: a receptor that mediates the interaction of activated platelets with neutrophils and monocytes.. Cell. 1989; 59(2):305-12. (Immunogen: Immunoaffinity chromatography, Immunoprecipitation, Radioimmunoassay, Western blot). View Reference
  7. Pigott R, Power C. The Adhesion Molecule Facts Book. 1993:173.
  8. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
View All (8) View Less
940309 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.