Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD54 (ICAM-1)

BD™ AbSeq Oligo Mouse Anti-Human CD54 (ICAM-1)

Clone HA58 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
ICAM-1; intercellular adhesion molecule 1; BB2; P3.58
3383
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT
AHS0076
IFN-γ-treated BM314 colonic carcinoma cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940072 Rev. 3
Antibody Details
Down Arrow Up Arrow
HA58

The HA58 monoclonal antibody specifically binds to CD54 which is also known as ICAM-1 (intracellular adhesion molecule-1).  CD54 is an 85-110 kDa type I transmembrane glycoprotein that belongs to the immunoglobulin supergene family. A soluble form of CD54 can also be found in biological fluids. CD54 is expressed on endothelial cells and both resting (weak) and activated (moderate) lymphocytes and monocytes. CD54 is a ligand for LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). The CD54 adhesion molecule plays roles in inflammatory and immune responses and neoplasia. This antibody (NA/LE format) blocks the mixed-lymphocyte reaction (MLR) and the purified format is suitable for staining acetone-fixed, frozen tissue sections.

940072 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940072 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940072" on CiteAb

Development References (4)

  1. Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997.
  2. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Tsujisaki M, Imai K, Hirata H, et al. Detection of circulating intercellular adhesion molecule-1 antigen in malignant diseases. Clin Exp Immunol. 1991; 85(1):3-8. (Immunogen: Blocking, ELISA, Flow cytometry, Immunoprecipitation, Radioimmunoassay, Western blot). View Reference
940072 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.