Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD32

BD™ AbSeq Oligo Mouse Anti-Human CD32

Clone FLI8.26 (also known as 8.26) (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
CD32a,FcγRIIa, FCGR2A; CD32b, FcγRIIb, FCGR2B; CD32c, FcγRIIc, FCGR2C
2212, 2213, 9103
2 µl
Mouse BALB/c IgG2b, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GGTTGTAGGTGCGGAATATAAGCGTCGTTGAGGTGT
AHS0073
K562 or FcγRII+ L cell lines
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940069 Rev. 3
Antibody Details
Down Arrow Up Arrow
FLI8.26

The FLI8.26 monoclonal antibody specifically recognizes CD32 which is also known as Fcγ receptor type II (FcγRII). CD32 is a type I transmembrane glycoprotein that serves as a low affinity receptor for aggregated IgG. The FLI8.26 antibody recognizes a, b, and c forms of CD32 that are encoded by separate genes: CD32a/FcγRIIa (FCGR2A), CD32b/FcγRIIb (FCGR2B), and CD32c/FcγRIIc (FCGR2C). These forms are differentially expressed on monocytes, granulocytes, T cells, B cells, NK cells, or platelets. These receptors play various roles in mediating and regulating inflammation and immunity including phagocytosis, cytotoxicity, degranulation, or platelet activation.

940069 Rev. 3
Format Details
Down Arrow Up Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940069 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940069" on CiteAb

Development References (5)

  1. Barclay NA, Brown MH, Birkeland ML, et al, ed. The Leukocyte Antigen FactsBook. San Diego, CA: Academic Press; 1997.
  2. Ierino FL, Hulett MD, McKenzie IF, Hogarth PM. Mapping epitopes of human Fc gamma RII (CDw32) with monoclonal antibodies and recombinant receptors. J Immunol. 1993; 150(5):1794-1803. (Immunogen: Blocking, Flow cytometry, Immunofluorescence, Immunoprecipitation, Radioimmunoassay). View Reference
  3. Schlossman SF. Stuart F. Schlossman .. et al., ed. Leucocyte typing V : white cell differentiation antigens : proceedings of the fifth international workshop and conference held in Boston, USA, 3-7 November, 1993. Oxford: Oxford University Press; 1995.
  4. Stuart SG, Simister NE, Clarkson SB, Kacinski BM, Shapiro M, Mellman I. Human IgG Fc receptor (hFcRII; CD32) exists as multiple isoforms in macrophages, lymphocytes and IgG-transporting placental epithelium. EMBO J. 1989; 8(12):3657-3666. (Biology). View Reference
  5. Tomiyama Y, Kunicki TJ, Zipf TF, Ford SB, Aster RH. Response of human platelets to activating monoclonal antibodies: importance of Fc gamma RII (CD32) phenotype and level of expression. Blood. 1992; 80(9):2261-2268. (Biology). View Reference
940069 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.