Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD3

BD™ AbSeq Oligo Mouse Anti-Human CD3

Clone UCHT1 (also known as UCHT-1; UCHT 1) (RUO)

742312
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
CD3e; CD3E; T3E; TCRE; T-cell surface antigen T3/Leu-4 epsilon
916
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG
AHS0231
Human infant thymocytes and peripheral blood lymphocytes from a Sézary Syndrome donor
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940307 Rev. 2
Antibody Details
Down Arrow
UCHT1

The UCHT1 monoclonal antibody specifically binds to the human CD3ε-chain, a 20-kDa subunit of the CD3/T cell antigen receptor complex. CD3ε is expressed on 70-80% of normal human peripheral blood lymphocytes and 60-85% of thymocytes. Studies from the HLDA Workshop show that this antibody is mitogenic for CD3ε-positive cells when used in conjunction with costimulatory agents such as pokeweed mitogen or anti-CD28 antibody. CD3 plays a central role in signal transduction during antigen recognition.  The UCHT1 antibody stains both surface and intracellular CD3ε unlike the other CD3 clone, HIT3a, that stains only extracellular CD3ε.

940307 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940307 Rev.2
Citations & References
Down Arrow

Development References (6)

  1. Beverley PC, Callard RE. Distinctive functional characteristics of human "T" lymphocytes defined by E rosetting or a monoclonal anti-T cell antibody. Eur J Immunol. 1981; 11(4):329-334. (Immunogen: Flow cytometry, Fluorescence activated cell sorting). View Reference
  2. Burns GF, Boyd AW, Beverley PC. Two monoclonal anti-human T lymphocyte antibodies have similar biologic effects and recognize the same cell surface antigen. J Immunol. 1982; 129(4):1451-1457. (Clone-specific: Blocking, Functional assay, Immunoprecipitation, Inhibition, Radioimmunoassay). View Reference
  3. Ernst DN, Shih CC. CD3 complex. J Biol Regul Homeost Agents. 2000; 14(3):226-229. (Biology). View Reference
  4. Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:1-1182.
  5. McMichael AJ. A.J. McMichael .. et al., ed. Leucocyte typing III : white cell differentiation antigens. Oxford New York: Oxford University Press; 1987:1-1050.
  6. Van Wauwe JP, Goossens JG, Beverley PC. Human T lymphocyte activation by monoclonal antibodies; OKT3, but not UCHT1, triggers mitogenesis via an interleukin 2-dependent mechanism. J Immunol. 1984; 133(1):129-132. (Clone-specific: Flow cytometry, Functional assay, Stimulation). View Reference
View All (6) View Less
940307 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.