Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD140b

Oligo Mouse Anti-Human CD140b

Clone 28D4

(RUO)
Product Details
Down Arrow Up Arrow


BD™ AbSeq
PDGF Receptor β chain; PDGFRβ; PDGFRB; PDGFR1; PDGFR; PGFRB; JTK12
2 µl
Mouse IgG2a, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GACAACATTTAGGACGTGACGAGAGAGTATAGCTTC
AHS0151
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. Please refer to bd.com/genomics-resources for technical protocols.
940237 Rev. 1
Antibody Details
Down Arrow Up Arrow
28D4

Reacts with platelet derived growth factor (PDGF) receptor β, a 170-190 kDa single transmembrane glycoprotein expressed on fibroblasts, smooth muscle cells, glial cells and chondrocytes. PDGF receptors, α and β, are single glycoproteins  with intracellular tyrosine kinase domains. They are structurally similar to M-CSF receptor and CD117 (c-kit). Their ligand, PDGF, is a mitogen for connective tissue cells and glial cells. PDGF plays a role in wound healing and acts as a chemoattractant for fibroblasts, smooth muscle cells, glial cells, monocytes and neutrophils. Functional PDGF is secreted as a disulfide-linked dimer of A and B chains (PDGF-AA, PDGF-BB or PDGF-AB). Binding of divalent PDGF induces receptor dimerization with three possible forms: αα, αβ, ββ. The PDGF receptor α-subunit binds both PDGF A and B chains, whereas the receptor β-subunit binds only PDGF B chain. Both receptor subunits can stimulate mitogenic responses, only the β subunit can induce chemotaxis. 28D4 is specific for PDGFRβ and does not cross-react with PDGFRα.

Application Notes

The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end.  The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.

NOTE:  The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.

940237 Rev. 1
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms. NOTE: The BD Rhapsody Single-Cell Analysis System must be used with the BD Rhapsody Express Instrument.
Antibody-Oligo
940237 Rev.1
Citations & References
Down Arrow Up Arrow

Development References (5)

  1. Battula VL, Treml S, Abele H, Buhring HJ. Prospective isolation and characterization of mesenchymal stem cells from human placenta using a frizzled-9-specific monoclonal antibody. Differentiation. 2008; 76(4):326-336. (Clone-specific: Flow cytometry). View Reference
  2. Claesson-Welsh L. Platelet-derived growth factor receptor signals. J Biol Chem. 1994; 269(51):32023-32026. (Biology). View Reference
  3. Ebert M, Kasper HU, Hernberg S, et al. Overexpression of platelet-derived growth factor (PDGF) B chain and type beta PDGF receptor in human chronic pancreatitis. Dig Dis Sci. 1998; 43(3):567-574. (Biology). View Reference
  4. Hart CE, Bowen-Pope DF. CD140a and b (PDGRα and β) Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:739-741.
  5. Yang M, Khachigian LM, Hicks C, Chesterman CN, Chong BH. Identification of PDGF receptors on human megakaryocytes and megakaryocytic cell lines. Thromb Haemost. 1997; 78(2):892-896. (Biology). View Reference
940237 Rev. 1

Please refer to Support Documents for Quality Certificates


Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.