Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD101

BD™ AbSeq Oligo Mouse Anti-Human CD101

Clone V7.1 (RUO)

940269
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
IGSF2; Cell surface glycoprotein V7; V7; EWI-101; P126
9398
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
CCAAGTTAGTTTAGTATGAGTATGCGAGCGTTTAGC
AHS0188
T cell clone CS1
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Please refer to bd.com/genomics-resources for technical protocols.
  8. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940269 Rev. 2
Antibody Details
Down Arrow
V7.1

The V7.1 monoclonal antibody specifically recognizes CD101 which is also known as P126 or Glu-Trp-Ile EWI motif-containing protein 101 (EWI-101). CD101 is encoded by IGSF2 (Immunoglobulin superfamily member 2) and belongs to the EWI (sharing a conserved glutamine-tryptophan-isoleucine motif) family within the Ig superfamily. CD101 is a ~135-140 kDa type I transmembrane glycoprotein that has a short cytoplasmic domain with potential phosphorylation sites and an extracellular region with seven immunoglobulin-variable (IgV)-like domains. CD101 is expressed as homodimers by granulocytes, monocytes, dendritic cells, and some T cells. Its expression by T cells may be upregulated upon activation through the CD3 complex. CD101 may play a role in TCR/CD3-dependent T-cell activation.

940269 Rev. 2
Format Details
Down Arrow
Ab-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Ab-Oligo
940269 Rev.2
Citations & References
Down Arrow

Development References (4)

  1. Boumsell L, Hall KT, Freeman GJ, Benussan A. CD101 Workshop Panel report. In: Kishimoto T. Tadamitsu Kishimoto .. et al., ed. Leucocyte typing VI : white cell differentiation antigens : proceedings of the sixth international workshop and conference held in Kobe, Japan, 10-14 November 1996. New York: Garland Pub.; 1997:1033-1034.
  2. Rivas A, Ruegg CL, Zeitung J, et al. V7, a novel leukocyte surface protein that participates in T cell activation. I. Tissue distribution and functional studies.. J Immunol. 1995; 154(9):4423-33. (Immunogen). View Reference
  3. Ruegg CL, Rivas A, Madani ND, Zeitung J, Laus R, Engleman EG. V7, a novel leukocyte surface protein that participates in T cell activation. II. Molecular cloning and characterization of the V7 gene.. J Immunol. 1995; 154(9):4434-43. (Clone-specific: Immunofluorescence, Immunoprecipitation, Radioimmunoassay). View Reference
  4. Soares LR, Rivas A, Ruegg C, Engleman EG. Differential response of CD4+ V7+ and CD4+ V7- T cells to T cell receptor-dependent signals: CD4+ V7+ T cells are co-stimulation independent and anti-V7 antibody blocks the induction of anergy by bacterial superantigen.. Eur J Immunol. 1997; 27(6):1413-21. (Clone-specific: Inhibition). View Reference
940269 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.