Skip to main content Skip to navigation
Hamburger Menu
Search icon
Country Selector Country Selector
Austria (English)
Profile Icon Profile Icon
Sign-in/Register UserName
Products

Solutions

Discover & Learn

Resources & Tools

Support

Search icon Search icon
Close Menu
      Alert Icon
      Oligo Hamster Anti-Mouse CD79b

      BD™ AbSeq Oligo Hamster Anti-Mouse CD79b

      Clone HM79b (also known as HM79-16)

      (RUO)
      Product Details
      Down Arrow Up Arrow


      BD™ AbSeq
      Igβ; Igb; Ig-beta; Immunoglobulin-associated beta
      15985
      2 µl
      Armenian Hamster IgG, λ1
      Mouse (Tested in Development)
      Single Cell 3' Sequencing (Qualified)
      GAGGTTCGAGGTAGGTATAATAAGATGGTTGAGAGC
      AMM2227
      Mouse B lymphoma, WEHI-123
      Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
      RUO
      Armenian Hamster


      Preparation And Storage

      Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
      Show More blue down arrow Show Less blue up arrow

      Recommended Assay Procedures

      Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

      BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

      Show More blue down arrow Show Less blue up arrow

      Product Notices

      1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
      2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
      3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
      4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
      5. Illumina is a trademark of Illumina, Inc.
      6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
      7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
      8. Please refer to bd.com/genomics-resources for technical protocols.
      9. For U.S. patents that may apply, see bd.com/patents.
      Show More blue down arrow Show Less blue up arrow
      940448 Rev. 2
      Antibody Details
      Down Arrow Up Arrow
      HM79b

      The HM79b monoclonal antibody specifically recognizes an extracellular epitope of Ig β chain (Igβ or CD79b), a 35-40-kDa transmembrane protein which forms an 80-90-kDa disulfide-linked heterodimer with Ig α chain (Igα or CD79a, 30-35 kDa).  On mature B lymphocytes, the CD79a/CD79b heterodimers are non-covalently associated with surface IgM to form the B-cell receptor complex (BCR). The presence of CD79a/CD79b is necessary for surface expression of the BCR and signal transduction via the BCR in B lymphocytes and pre-B cells. It was recently reported that CD79b may be expressed on the cell surface preceding the appearance of surface IgM during B-lymphocyte development. At this pro-B-cell stage, CD79b participates in signal transduction involved in the regulation of B-cell development. It should be noted that multi-parameter flow cytometric analyses of bone marrow suspensions performed at BD Biosciences Pharmingen have been unable to detect surface staining by HM79b mAb on CD45R/B220+ IgM- cells.

      940448 Rev. 2
      Format Details
      Down Arrow Up Arrow
      Antibody-Oligo
      The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
      Antibody-Oligo
      940448 Rev.2
      Citations & References
      Down Arrow Up Arrow

      Development References (7)

      1. Gong S, Nussenzweig MC. Regulation of an early developmental checkpoint in the B cell pathway by Ig beta. Science. 1996; 272(5260):411-414. (Biology). View Reference
      2. Koyama M, Ishihara K, Karasuyama H, Cordell JL, Iwamoto A, Nakamura T. CD79 alpha/CD79 beta heterodimers are expressed on pro-B cell surfaces without associated mu heavy chain. Int Immunol. 1997; 9(11):1767-1772. (Immunogen). View Reference
      3. Nagata K, Nakamura T, Kitamura F, et al. The Ig alpha/Igbeta heterodimer on mu-negative proB cells is competent for transducing signals to induce early B cell differentiation. Immunity. 1997; 7(4):559-570. (Biology). View Reference
      4. Papavasiliou F, Jankovic M, Suh H, Nussenzweig MC. The cytoplasmic domains of immunoglobulin (Ig) alpha and Ig beta can independently induce the precursor B cell transition and allelic exclusion. J Exp Med. 1995; 182(5):1389-1394. (Biology). View Reference
      5. Papavasiliou F, Misulovin Z, Suh H, Nussenzweig MC. The role of Ig beta in precursor B cell transition and allelic exclusion. Science. 1995; 268(5209):408-411. (Biology). View Reference
      6. Pleiman CM, D'Ambrosio D, Cambier JC. The B-cell antigen receptor complex: structure and signal transduction. Immunol Today. 1994; 15(9):393-399. (Biology). View Reference
      7. Reth M. Antigen receptors on B lymphocytes. Annu Rev Immunol. 1992; 10:97-121. (Biology). View Reference
      View All (7) View Less
      940448 Rev. 2

      Please refer to Support Documents for Quality Certificates


      Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described


      Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

      For Research Use Only. Not for use in diagnostic or therapeutic procedures.

      Website Feedback