Skip to main content Skip to navigation
Oligo Hamster Anti-Mouse CD49e

BD™ AbSeq Oligo Hamster Anti-Mouse CD49e

Clone HM alpha 5-1 (RUO)

610717
Sign In
EA (1 Each)
25 Tests
Product Details
Down Arrow


BD™ AbSeq
ITGA5; Integrin α5 chain; VLA-5α-chain; VLA5a VLA-5a; Fnra
16402
2 µl
Armenian Hamster IgG1, κ
Mouse (Tested in Development)
Single Cell 3' Sequencing (Qualified)
GTGATTCAAGTAGATAGGGATGGTTCGTAAGATGTG
AMM2178
Affinity-purified mouse VLA-5 protein (α5β1, CD49e/CD29)
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Armenian Hamster


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  5. Illumina is a trademark of Illumina, Inc.
  6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
  8. Please refer to bd.com/genomics-resources for technical protocols.
  9. For U.S. patents that may apply, see bd.com/patents.

Data Sheets

940421 Rev. 2
Antibody Details
Down Arrow
HM alpha 5-1

The HMα5-1 antibody specifically recognizes the α5 subunit of the integrin α5β1 fibronectin receptor (CD49e/CD29, VLA-5) on mouse thymocytes and a variety of mouse cell lines, including pre-B and non-lymphoid cells, but not on mouse splenic or lymph node cells. It also detects rat CD49e on the RBL2H3 basophilic leukemia cell line,peritoneal mast cells, and endothelium, but not on splenocytes. It has been reported that soluble mAb HMα5-1 partially inhibits in vitro binding of a mouse cell line and of rat mast cells to fibronectin and inhibits the enhanced degranulation of IgE-sensitized rat RBL cells induced on fibronectin-coated plates. It has also been observed that plate-bound HMα5-1 antibody enhances the degranulation of IgEsensitized rat RBL-2H3 cells and that subcutaneous injection of HMα5-1 mAb into rats, along with anti-CD49d and anti-CD61 antibodies, inhibits experimentally induced passive cutaneous anaphylaxis.

940421 Rev. 2
Format Details
Down Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940421 Rev.2
Citations & References
Down Arrow

Development References (4)

  1. Narumiya S, Abe Y, Kita Y, et al. Pre-B cells adhere to fibronectin via interactions of integrin alpha 5/alpha V with RGDS as well as of integrin alpha 4 with two distinct V region sequences at its different binding sites. Int Immunol. 1994; 6(1):139-147. (Immunogen). View Reference
  2. Noto K, Kato K, Okumura K, Yagita H. Identification and functional characterization of mouse CD29 with a mAb. Int Immunol. 1995; 7(5):835-842. (Clone-specific: Activation, Inhibition). View Reference
  3. Tanaka T, Ohtsuka Y, Yagita H, Shiratori Y, Omata M, Okumura K. Involvement of alpha 1 and alpha 4 integrins in gut mucosal injury of graft-versus-host disease. Int Immunol. 1995; 7(8):1183-1189. (Biology). View Reference
  4. Yasuda M, Hasunuma Y, Adachi H, et al. Expression and function of fibronectin binding integrins on rat mast cells.. Int Immunol. 1995; 7(2):251-8. (Immunogen: Activation, Immunoprecipitation, Inhibition). View Reference
940421 Rev. 2

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.