Skip to main content Skip to navigation
Oligo Mouse Anti-Human CD25 (IL-2 Receptor α)

BD™ AbSeq Oligo Mouse Anti-Human CD25 (IL-2 Receptor α)

Clone 2A3 (RUO)

Product Details
Down Arrow Up Arrow


BD™ AbSeq
IL-2R; IL2RA; IL-2Rα; TCGFR; TAC antigen; p55
3559
2 µl
Mouse BALB/c IgG1, κ
Human (Tested in Development)
Single Cell 3' Sequencing (Qualified)
AGTTGTATGGGTTAGCCGAGAGTAGTGCGTATGATT
AHS0026
Human Phytohemagglutinin-activated T Cells
Aqueous buffered solution containing BSA and ≤0.09% sodium azide.
RUO
Mouse


Preparation And Storage

Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.

Recommended Assay Procedures

Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette.

BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.

Product Notices

  1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
  2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
  3. Please refer to bd.com/genomics-resources for technical protocols.
  4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
  5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
  6. Illumina is a trademark of Illumina, Inc.
  7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
  8. For U.S. patents that may apply, see bd.com/patents.
940009 Rev. 3
Antibody Details
Down Arrow Up Arrow
2A3

The 2A3 monoclonal antibody specifically binds to human CD25, the low-affinity alpha subunit of the Interleukin-2 Receptor (IL- 2Rα). CD25 associates with CD122 (IL-2Rβ chain) and CD132 (common γ chain or γc) to form the high-affinity signal-transducing IL-2R complex. CD25 is expressed by subsets of thymocytes and peripheral blood lymphocytes including CD4+CD25+ regulatory T cells and memory T cells. CD25 antigen density increases on activated T cells including phytohemagglutinin (PHA)-, concanavalin A (Con A)-, and CD3-activated T lymphocytes. High levels of CD25 can be expressed by T lymphocytes from mixed lymphocyte cultures and by human T-lymphocyte leukemia virus (HTLV)-infected T-lymphocyte leukemia lines, for example, HUT-102. CD25 can also be expressed by activated B cells and macrophages. Recombinant IL-2 blocks the binding of the 2A3 antibody to PHA-activated T lymphocytes.

940009 Rev. 3
Format Details
Down Arrow Up Arrow
Antibody-Oligo
The antibody was conjugated to an oligonucleotide that contains an antibody clone-specific barcode (ABC) flanked by a poly-A tail on the 3' end and a PCR handle (PCR primer binding site) on the 5' end. The ABC for this antibody was designed to be used with other BD® AbSeq oligonucleotides conjugated to other antibodies. All AbSeq ABC sequences were selected in silico to be unique from human and mouse genomes, have low predicted secondary structure, and have high Hamming distance within the BD® AbSeq portfolio, to allow for sequencing error correction and unique mapping. The poly-A tail of the oligonucleotide allows the ABC to be captured by the BD Rhapsody™ system. The 5' PCR handle allows for efficient sequencing library generation for Illumina sequencing platforms.NOTE: The BD Rhapsody™ Single-Cell Analysis System must be used with the BD Rhapsody™ Express Instrument.
Antibody-Oligo
940009 Rev.3
Citations & References
Down Arrow Up Arrow
View product citations for antibody "940009" on CiteAb

Development References (13)

  1. Dower SK, Hefeneider SH, Alpert AR, Urdal DL. Quantitative measurement of human interleukin 2 receptor levels with intact and detergent-solubilized human T-cells. Mol Immunol. 1985; 22(8):937-947. (Clone-specific). View Reference
  2. Greene WC, Leonard WJ. The human interleukin-2 receptor. Annu Rev Immunol. 1986; 4:69-95. (Clone-specific). View Reference
  3. Jackson AL, Matsumoto H, Janszen M, Maino V, Blidy A, Shye S. Restricted expression of p55 interleukin 2 receptor (CD25) on normal T cells. Clin Immunol Immunopathol. 1990; 54(1):126-133. (Clone-specific: Flow cytometry). View Reference
  4. Lando Z, Sarin P, Megson M, et al. Association of human T-cell leukaemia/lymphoma virus with the Tac antigen marker for the human T-cell growth factor receptor. Nature. 1983; 305(5936):733-736. (Biology). View Reference
  5. Leonard WJ, Depper JM, Uchiyama T, Smith KA, Waldmann TA, Greene WC. A monoclonal antibody that appears to recognize the receptor for human T-cell growth factor; partial characterization of the receptor. Nature. 1982; 300(5889):267-269. (Biology). View Reference
  6. Ng WF, Duggan PJ, Ponchel F, et al. Human CD4(+)CD25(+) cells: a naturally occurring population of regulatory T cells. Blood. 2001; 98(9):2736-2744. (Biology). View Reference
  7. Rambaldi A, Young DC, Herrmann F, Cannistra SA, Griffin JD. Interferon-gamma induces expression of the interleukin 2 receptor gene in human monocytes. Eur J Immunol. 1987; 17(1):153-156. (Clone-specific). View Reference
  8. Robb RJ, Greene WC, Rusk CM. Low and high affinity cellular receptors for interleukin 2. Implications for the level of Tac antigen. J Exp Med. 1984; 160(4):1126-1146. (Biology). View Reference
  9. Schwarting R, Stein H. Cluster report: CD25. In: Knapp W. W. Knapp .. et al., ed. Leucocyte typing IV : white cell differentiation antigens. Oxford New York: Oxford University Press; 1989:399-403.
  10. Sereti I, Martinez-Wilson H, Metcalf JA, et al. Long-term effects of intermittent interleukin 2 therapy in patients with HIV infection: characterization of a novel subset of CD4(+)/CD25(+) T cells. Blood. 2002; 100(6):2159-2167. (Clone-specific: Flow cytometry). View Reference
  11. Siegel JP, Sharon M, Smith PL, Leonard WJ. The IL-2 receptor beta chain (p70): role in mediating signals for LAK, NK, and proliferative activities. Science. 1987; 238(4823):75-78. (Biology). View Reference
  12. Teshigawara K, Wang HM, Kato K, Smith KA. Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 1987; 165(1):223-238. (Biology). View Reference
  13. Urdal DL, March CJ, Gillis S, Larsen A, Dower SK. Purification and chemical characterization of the receptor for interleukin 2 from activated human T lymphocytes and from a human T-cell lymphoma cell line. Proc Natl Acad Sci U S A. 1984; 81(20):6481-6485. (Immunogen: Blocking, Dot Blot, Immunoaffinity chromatography, Inhibition, Radioimmunoassay). View Reference
View All (13) View Less
940009 Rev. 3

Please refer to Support Documents for Quality Certificates

 

Global - Refer to manufacturer's instructions for use and related User Manuals and Technical data sheets before using this products as described

 

Comparisons, where applicable, are made against older BD Technology, manual methods or are general performance claims.  Comparisons are not made against non-BD technologies, unless otherwise noted.

For Research Use Only. Not for use in diagnostic or therapeutic procedures.